Have questions? Visit https://www.reddit.com/r/SNPedia

Serotonin/all

From SNPedia

Serotonin synthesis[edit]

 On chromosomeChromosome positionIn geneSummary
rs3665901116,850,893PLEKHA7
rs21089771118,019,049TPH1
rs79335051118,024,440TPH1
Rs1799913(C;C)1118,025,708TPH1Hispanics may be at increased risk of heroin addiction.
rs17999131118,025,708TPH1heroin addiction in hispanics
rs18005321118,026,269TPH1
rs2111051118,033,757TPH1
rs6843021118,038,806TPH1
rs6235801118,042,430TPH1
 On chromosomeChromosome positionIn geneSummary
rs44897891270,665,152PTPRR
Rs4489789(T;T)1270,665,152PTPRRcommon in complete genomics
rs21757111270,679,733PTPRR
rs22032311270,686,988PTPRR
Rs4570625(G;T)1271,938,143TPH2normal
Rs4570625(T;T)1271,938,143TPH2normal
rs4570625(G;G)1271,938,143TPH2maybe: higher scores on anxiety-related personality traits; greater placebo response
rs45706251271,938,143TPH2
rs111789971271,938,373TPH2
Rs11178997(T;T)1271,938,373TPH2
rs111789981271,938,935TPH2
Rs11178998(A;A)1271,938,935TPH2
rs43415811271,941,293TPH2
rs79547581271,942,014TPH2
rs107481851271,942,075TPH2
Rs4565946(C;T)1271,942,989TPH2
Rs4565946(C;C)1271,942,989TPH2Risk of early-onset OCD
Rs4565946(T;T)1271,942,989TPH2None
rs45659461271,942,989TPH2
rs111790001271,944,848TPH2
rs111790021271,948,504TPH2
rs18438091271,954,918TPH2
rs79555011271,956,246TPH2
rs13864961271,957,010TPH2
rs13864941271,958,763TPH2
Rs1386494(T;C)1271,958,763TPH2
rs13864931271,961,399TPH2
rs21713631271,966,484TPH2
rs79637201271,972,406TPH2
Rs17110563(C;C)1271,972,526TPH2common in complete genomics
rs171105631271,972,526TPH2
rs47608161271,978,821TPH2
Rs120074176(C;T)1271,979,053TPH2Possible increased risk for ADHD and other psychiatric disorders
Rs120074176(C;C)1271,979,053TPH2common in complete genomics
rs1200741761271,979,053TPH2
Rs7305115(A;A)1271,979,082TPH2Individuals showed a significantly lower risk of suicide behavior than those with the A/G or G/G genotype
Rs7305115(A;G)1271,979,082TPH2risk of suicide behavior
rs73051151271,979,082TPH2
Rs7305115(G;G)1271,979,082TPH2risk of suicide behavior
rs111790271271,983,532TPH2
rs105066451271,991,720TPH2
rs10070231271,994,594TPH2
rs13864971271,998,510TPH2
rs47608201272,003,216TPH2
rs13864981272,004,363TPH2
rs14872781272,007,071TPH2
rs14734731272,010,598TPH2
rs14872761272,011,279TPH2
rs171106901272,014,217TPH2
rs14872751272,016,512TPH2
... further results
 On chromosomeChromosome positionIn geneSummary
rs2060762750,461,686DDC
rs2242041750,461,751DDC
rs3757472750,470,285DDC
rs11761683750,475,181DDC
Rs11761683(T;T)750,475,181DDCMigraine
rs201951824750,476,625DDC
rs11575461750,479,485DDC
rs12718541750,482,446DDC
Rs12718541(A;A)750,482,446DDCNicotine dependence
rs1451371750,485,353DDC
rs137853209750,495,369DDC
Rs137853209(T;T)750,495,369DDCcommon in clinvar
Rs137853212(G;G)750,499,201DDCcommon in clinvar
rs137853212750,499,201DDC
Rs137853208(C;C)750,504,025DDCcommon in clinvar
rs137853208750,504,025DDC
rs6592961750,505,192DDC
rs1470750750,508,950DDC
rs3735273750,529,166DDC
rs137853210750,529,339DDC
Rs137853210(A;A)750,529,339DDCcommon in clinvar
rs998850750,539,690DDC
RGPD2
rs137853207750,539,926DDC
DDC-AS1
Rs137853207(G;G)750,539,926DDC
DDC-AS1
common in clinvar
Rs137853211(C;C)750,539,958DDC
DDC-AS1
common in clinvar
rs137853211750,539,958DDC
DDC-AS1
rs7809234750,542,681DDC
DDC-AS1
rs6264750,544,037DDC
Rs6264(G;G)750,544,037DDCcommon in complete genomics
Rs2044859(T;T)750,544,864DDCMigraine
rs2044859750,544,864DDC
Rs11974297(G;G)750,550,562DDCMigraine
rs11974297750,550,562DDC
rs2329340750,552,531DDC
Rs2329340(T;T)750,552,531DDCM
rs1451375750,555,014DDC
rs921451750,555,587DDC
rs3837091750,561,043DDC
rs12540874750,597,225GRB10

Serotonin degradation[edit]

 On chromosomeChromosome positionIn geneSummary
rs5953210X43,654,798MAOA
rs5906883X43,667,695MAOA
rs1465107X43,678,769MAOA
rs796065312X43,683,572MAOA
rs5906957X43,688,062MAOA
rs909525X43,693,955MAOABest proxy for Warrior Gene repeats.
Rs909525(A;A)X43,693,955MAOAProbably MAOA 4 or 5 repeats: not Warrior Gene.
Rs909525(G;G)X43,693,955MAOAPerhaps MAOA 3 repeats: Warrior Gene?
Rs909525(A;G)X43,693,955MAOAProbably one Warrior Gene and one non-Warrior Gene.
rs2283725X43,700,729MAOA
rs796065311X43,731,344MAOA
rs587777457X43,731,695MAOA
Rs587777457(G;G)X43,731,695MAOAcommon in clinvar
Rs72554632(C;C)X43,731,784MAOAcommon in clinvar
Rs72554632(C;T)X43,731,784MAOACarrier for Brunner's Syndrome
Rs72554632(T;T)X43,731,784MAOApossible mental retardation
rs72554632X43,731,784MAOA
Rs6323(T;T)X43,731,789MAOAreduced MAOA activity
rs6323X43,731,789MAOAMonoamine oxidase A activity
Rs6323(G;G)X43,731,789MAOAIncreased monoamine oxidase A activity
rs3027400X43,733,516MAOA
rs2235186X43,736,181MAOA
rs2072743X43,740,274MAOA
rs979606X43,741,895MAOA
rs1137070X43,744,144MAOA
rs3027407X43,745,594MAOA
rs3027409X43,747,786MAOA
Rs3027409(T;T)X43,747,786MAOAcommon on affy axiom data
rs6609257X43,753,461MAOA

Serotonin transporters[edit]

 On chromosomeChromosome positionIn geneSummary
rs38130341730,197,786SLC6A4
Rs1042173(G;T)1730,197,993SLC6A4normal
Rs1042173(T;T)1730,197,993SLC6A4among alcoholics, likely to be heavier drinkers
rs10421731730,197,993SLC6A4
Rs1042173(G;G)1730,197,993SLC6A4normal
rs124497831730,200,635SLC6A4
rs37948081730,204,775SLC6A4
rs20548471730,204,995SLC6A4
rs343881961730,207,451SLC6A4
Rs28914832(A;A)1730,211,356SLC6A4common in complete genomics
rs289148321730,211,356SLC6A4
Rs140701(G;G)1730,211,514SLC6A4Normal risk for anxiety disorders
rs1407011730,211,514SLC6A4
Rs140701(A;A)1730,211,514SLC6A4Increased risk for anxiety disorders
Rs140701(A;G)1730,211,514SLC6A4Increased risk for anxiety disorders
rs45833061730,211,697SLC6A4
rs1407001730,216,371SLC6A4
Rs140700(C;C)1730,216,371SLC6A4
Rs2020942(A;G)1730,219,896SLC6A4common in complete genomics
rs20209421730,219,896SLC6A4
rs80760051730,220,192SLC6A4
rs110801221730,220,317SLC6A4
rs570983341730,221,570SLC6A4
rs63541730,222,880SLC6A4
rs255281730,222,960SLC6A4
rs20209361730,223,796SLC6A4
rs121502141730,223,870SLC6A4
Rs2066713(C;T)1730,224,647SLC6A4common in complete genomics
rs20667131730,224,647SLC6A4
Rs4251417(G;G)1730,224,840SLC6A4
rs42514171730,224,840SLC6A4
rs80716671730,225,755SLC6A4
rs169656281730,228,407SLC6A4
rs20209341730,234,442SLC6A4
rs20209331730,234,737SLC6A4
Rs2020933(T;T)1730,234,737SLC6A4
rs255331730,235,874SLC6A4
Rs25533(T;T)1730,235,874SLC6A4common in complete genomics
Rs25532(C;C)1730,237,152SLC6A4may be part of a haplotype associated with OCD
rs255321730,237,152SLC6A4
Rs25532(C;T)1730,237,152SLC6A4may be part of a haplotype associated with OCD
Rs25532(T;T)1730,237,152SLC6A4normal
rs255311730,237,328SLC6A4
Rs25531(-;-)1730,237,328SLC6A4
rs25531(G;G)1730,237,328SLC6A4long form of 5-HTTLPR. less sensitive to pain
Rs25531(A;A)1730,237,328SLC6A4short form of 5-HTTLPR. lower levels of serotonin, slightly less happy, benefits from more support
Rs4795541(-;AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG)1730,237,341SLC6A4complex; see details
Rs4795541(AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG;AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG)1730,237,341SLC6A4complex; see details
rs47955411730,237,341SLC6A4
Rs4795541(-;-)1730,237,341SLC6A4normal
 On chromosomeChromosome positionIn geneSummary
rs6091214310117,241,017SLC18A2
rs36338710117,244,053SLC18A2
Rs363387(T;T)10117,244,053SLC18A2
rs201558610117,262,226SLC18A2
rs36322410117,263,062SLC18A2
rs36322710117,267,055SLC18A2
rs36327610117,274,298SLC18A2

Serotonin receptors[edit]

 On chromosomeChromosome positionIn geneSummary
rs7445832563,290,474
rs878567563,960,164HTR1A
rs6449693563,960,191HTR1A
rs34118353563,961,168HTR1A
rs112846276563,961,175HTR1A
rs6294563,961,426HTR1A
rs367956927563,962,199HTR1A
Rs367956927(T;T)563,962,199HTR1Acommon in clinvar
rs6295563,962,738HTR1A
rs113195492563,962,787HTR1A
 On chromosomeChromosome positionIn geneSummary
Rs13212041(C;C)677,461,407HTR1B
rs13212041677,461,407HTR1B
rs6296677,462,543HTR1B
rs130058677,463,564HTR1B
rs11568817677,463,665HTR1B
rs4140535677,465,335HTR1B
 On chromosomeChromosome positionIn geneSummary
rs3828741687,015,956HTR1E
Rs3828741(C;C)687,015,956HTR1Ecommon in complete genomics
 On chromosomeChromosome positionIn geneSummary
rs31251346,834,716HTR2A
Rs6314(C;C)1346,834,899HTR2Ahigher risk for RA
Rs6314(C;T)1346,834,899HTR2Ahigher risk for RA; better response to paroxetine as treatment for depression
Rs6314(T;T)1346,834,899HTR2Aaverage
rs63141346,834,899HTR2A
rs73223471346,835,968HTR2A
rs79970121346,837,850HTR2A
Rs7997012(A;A)1346,837,850HTR2A~18% more likely to respond to citalopram
Rs7997012(G;G)1346,837,850HTR2A~18% less likely to respond to citalopram
Rs7997012(A;G)1346,837,850HTR2Anormal risk
rs37422781346,845,442HTR2A
rs65613331346,846,177HTR2A
rs19238861346,849,156HTR2A
rs17458371346,850,677HTR2A
HTR2A-AS1
rs6558881346,854,046HTR2A
HTR2A-AS1
rs22969721346,854,336HTR2A
HTR2A-AS1
rs6436271346,854,476HTR2A
HTR2A-AS1
Rs643627(T;C)1346,854,476HTR2A
HTR2A-AS1
Rs7984966(C;C)1346,855,311HTR2A
HTR2A-AS1
ADHD in adults
rs79849661346,855,311HTR2A
HTR2A-AS1
rs22247211346,858,019HTR2A
rs93162331346,859,220HTR2A
rs27702921346,860,971HTR2A
Rs659734(T;T)1346,861,148HTR2Acommon in complete genomics
rs6597341346,861,148HTR2A
rs19280421346,863,081HTR2A
rs27702961346,866,425HTR2A
Rs1328674(A;G)1346,867,572HTR2Ahigher risk for RA
Rs1328674(G;G)1346,867,572HTR2Aaverage
rs13286741346,867,572HTR2A
Rs1328674(A;A)1346,867,572HTR2Ahigher risk for RA
rs5823851346,871,859HTR2A
rs19280401346,873,101HTR2A
rs27703041346,881,230HTR2A
rs9275441346,881,916HTR2A
rs172887231346,883,558HTR2A
rs5942421346,883,917HTR2A
Rs594242(C;G)1346,883,917HTR2A
Rs9534505(G;G)1346,886,609HTR2Acommon in complete genomics
rs95345051346,886,609HTR2A
rs20700371346,892,935HTR2A
Rs6313(T;T)1346,895,805HTR2Adepression, panic, stress response
rs63131346,895,805HTR2A
Rs6313(C;C)1346,895,805HTR2Ahigher risk for RA
Rs6313(C;T)1346,895,805HTR2Ahigher risk for RA
Rs6311(C;T)1346,897,343HTR2ANormal risk of sexual dysfunction when taking SSRI Antidepressants.
rs63111346,897,343HTR2A
Rs6311(T;T)1346,897,343HTR2ANormal (lower) risk of sexual dysfunction when taking SSRI Antidepressants.
rs6311(C;C)1346,897,343HTR2A3.6x increased risk of sexual dysfunction when taking SSRI Antidepressants.
 On chromosomeChromosome positionIn geneSummary
rs101947762231,115,305HTR2B
PSMD1
rs168278012231,116,063HTR2B
PSMD1
rs79874540(C;T)2231,123,707HTR2B
PSMD1
2-3 fold higher risk of impulsive/aggressive behaviour when drunk
rs798745402231,123,707HTR2B
PSMD1
Rs79874540(C;C)2231,123,707HTR2B
PSMD1
common in complete genomics
rs79874540(T;T)2231,123,707HTR2B
PSMD1
Increased risk for impulsive/aggressive behaviour when drunk
 On chromosomeChromosome positionIn geneSummary
rs521018X114,583,441HTR2C
rs498207X114,583,649HTR2C
rs3813928X114,583,809HTR2C
Rs3813929(C;C)X114,584,047HTR2Cpossible weight gain if taking olanzapine
Rs3813929(C;T)X114,584,047HTR2Cnormal
Rs3813929(T;T)X114,584,047HTR2Cnormal
rs3813929X114,584,047HTR2C
Rs518147(G;G)X114,584,109HTR2Cnormal
Rs518147(C;C)X114,584,109HTR2Cless weight gain if taking olanzapine
rs518147X114,584,109HTR2C
Rs518147(C;G)X114,584,109HTR2Cnormal
rs498177X114,590,222HTR2C
rs6318X114,731,326HTR2C
Rs6318(G;G)X114,731,326HTR2Ccommon in clinvar
Rs6318(C;G)X114,731,326HTR2CFemale only, since on X ch; appears to mostly be = to common (G;G) genotype
Rs6318(C;C)X114,731,326HTR2C1.4x increased risk for cardiac events in patients; apparently stress (cortisol) related
rs1414334X114,903,581HTR2C
rs1414334(C;C)X114,903,581HTR2Cassociated with metabolic syndrome when taking antipsychotics
 On chromosomeChromosome positionIn geneSummary
rs115022611113,974,819HTR3A
Rs1150226(C;C)11113,974,819HTR3Acommon in complete genomics
rs106261311113,975,284HTR3A
rs3394020811113,975,355HTR3A
rs198524211113,977,551HTR3A
rs227630211113,979,418HTR3A
rs1016054811113,985,959HTR3A
rs117671311113,989,703HTR3A
 On chromosomeChromosome positionIn geneSummary
rs1078997011113,903,224HTR3B
rs375898711113,904,553HTR3B
Rs45460698(AAG;AAG)11113,904,832HTR3B
rs4546069811113,904,832HTR3B
Rs11606194(T;T)11113,910,259HTR3B
rs1160619411113,910,259HTR3B
rs117674411113,932,306HTR3B
rs227630511113,932,382HTR3B
Rs2276307(A;A)11113,933,165HTR3B
rs227630711113,933,165HTR3B
rs378202511113,936,885HTR3B
rs167271711113,942,011HTR3B
 On chromosomeChromosome positionIn geneSummary
rs118203884MT4,409HTR3C
Rs118203884(T;T)MT4,409HTR3Ccommon in clinvar
rs67664103184,056,974HTR3C
Rs6807362(C;C)3184,060,222HTR3Cincreased autism risk
Rs6807362(G;G)3184,060,222HTR3Cdecreased autism risk
rs68073623184,060,222HTR3C
Rs6807362(C;G)3184,060,222HTR3Cnormal autism risk
rs68076703184,060,510HTR3C
rs3981246463185,254,016EHHADH
MIR5588
Rs398124646(G;G)3185,254,016EHHADH
MIR5588
common in clinvar
 On chromosomeChromosome positionIn geneSummary
rs64439303184,036,506HTR3D
 On chromosomeChromosome positionIn geneSummary
rs76276153184,100,628HTR3E
rs626250443184,106,769HTR3E
rs561098473184,106,769HTR3E
Rs56109847(G;G)3184,106,769HTR3Ecommon in complete genomics
 On chromosomeChromosome positionIn geneSummary
Rs515726208(G;G)5147,824,702SPINK1common in clinvar
rs5157262085147,824,702SPINK1
Rs148954387(A;A)5147,828,020SPINK1common in clinvar
rs1489543875147,828,020SPINK1
Rs515726207(A;A)5147,828,056SPINK1common in clinvar
rs5157262075147,828,056SPINK1
rs5157262065147,828,066SPINK1
Rs515726206(A;A)5147,828,066SPINK1common in clinvar
Rs17107315(C;T)5147,828,115SPINK1risk of pancreatitis
Rs17107315(C;C)5147,828,115SPINK1risk of pancreatitis
rs171073155147,828,115SPINK1
Rs17107315(T;T)5147,828,115SPINK1normal
rs1048939395147,831,537SPINK1
Rs104893939(T;T)5147,831,537SPINK1common in clinvar
rs1939226595147,831,551SPINK1
Rs193922659(C;C)5147,831,551SPINK1common in clinvar
rs1048939385147,831,576SPINK1
Rs104893938(T;T)5147,831,576SPINK1common in clinvar
rs289357685147,831,576SPINK1
Rs28935768(T;T)5147,831,576SPINK1
rs8919925147,845,951
rs14329825147,854,895
rs100354325147,855,193
rs111680485148,462,790HTR4
rs39950905148,466,252HTR4
rs77330885148,476,770HTR4
rs93251045148,543,814HTR4
 On chromosomeChromosome positionIn geneSummary
rs102397947154,508,809DPP6
Rs10239794(T;T)7154,508,809DPP6>1.3x risk for ALS
Rs10239794(C;C)7154,508,809DPP6average
Rs10239794(C;T)7154,508,809DPP61.3x risk for ALS
rs18008837155,070,881DOPEY1
HTR5A
rs63207155,070,911HTR5A
HTR5AOS
 On chromosomeChromosome positionIn geneSummary
rs1805054119,666,020HTR6
Rs1805054(C;C)119,666,020HTR6common in complete genomics
rs4654903119,874,497
 On chromosomeChromosome positionIn geneSummary
rs122493771090,833,199HTR7
rs19353491090,834,586HTR7
rs111870331092,502,602IDE
rs18321961092,508,577IDE
Rs7895832(A;A)1092,516,769IDEcommon in complete genomics
rs78958321092,516,769IDE
rs70784131092,530,727IDE
rs111870611092,545,652IDE
Rs17107734(C;C)1092,545,660IDEcommon in complete genomics
rs171077341092,545,660IDE
rs111870651092,552,167IDE
rs19997641092,560,382IDE
rs46469541092,574,070IDE
Rs4646954(G;G)1092,574,070IDEcommon in complete genomics
rs46469531092,574,198IDE
rs37585051092,575,021IDE
Rs3758505(T;T)1092,575,021IDEcommon in complete genomics
rs65838261092,588,073
rs7970456501092,609,068KIF11