Have questions? Visit https://www.reddit.com/r/SNPedia

Serotonin/all

From SNPedia

Serotonin synthesis[edit]

 On chromosomeChromosome positionIn geneSummary
Rs3665901116,850,893PLEKHA7
Rs21089771118,019,049TPH1
Rs79335051118,024,440TPH1
Rs1799913(C;C)1118,025,708TPH1Hispanics may be at increased risk of heroin addiction.
Rs17999131118,025,708TPH1heroin addiction in hispanics
Rs18005321118,026,269TPH1
Rs2111051118,033,757TPH1
Rs211105(T;G)1118,033,757TPH1
Rs6843021118,038,806TPH1
 On chromosomeChromosome positionIn geneSummary
Rs4489789(T;T)1270,665,152PTPRRcommon in complete genomics
Rs44897891270,665,152PTPRR
Rs21757111270,679,733PTPRR
Rs22032311270,686,988PTPRR
Rs4570625(G;G)1271,938,143TPH2higher scores on anxiety-related personality traits; greater placebo response
Rs4570625(G;T)1271,938,143TPH2normal
Rs4570625(T;T)1271,938,143TPH2normal
Rs45706251271,938,143TPH2
Rs111789971271,938,373TPH2
Rs11178997(T;T)1271,938,373TPH2
Rs11178998(A;A)1271,938,935TPH2
Rs111789981271,938,935TPH2
Rs43415811271,941,293TPH2
Rs79547581271,942,014TPH2
Rs107481851271,942,075TPH2
Rs4565946(T;T)1271,942,989TPH2None
Rs4565946(C;T)1271,942,989TPH2
Rs4565946(C;C)1271,942,989TPH2Risk of early-onset OCD
Rs45659461271,942,989TPH2
Rs111790001271,944,848TPH2
Rs111790021271,948,504TPH2
Rs18438091271,954,918TPH2
Rs79555011271,956,246TPH2
Rs13864961271,957,010TPH2
Rs13864941271,958,763TPH2
Rs1386494(T;C)1271,958,763TPH2
Rs13864931271,961,399TPH2
Rs21713631271,966,484TPH2
Rs79637201271,972,406TPH2
Rs17110563(C;C)1271,972,526TPH2common in complete genomics
Rs171105631271,972,526TPH2
Rs47608161271,978,821TPH2
Rs120074176(C;C)1271,979,053TPH2common in complete genomics
Rs1200741761271,979,053TPH2
Rs7305115(A;A)1271,979,082TPH2Individuals showed a significantly lower risk of suicide behavior than those with the A/G or G/G genotype
Rs73051151271,979,082TPH2
Rs7305115(A;G)1271,979,082TPH2risk of suicide behavior
Rs7305115(G;G)1271,979,082TPH2risk of suicide behavior
Rs111790271271,983,532TPH2
Rs105066451271,991,720TPH2
Rs10070231271,994,594TPH2
Rs13864971271,998,510TPH2
Rs47608201272,003,216TPH2
Rs13864981272,004,363TPH2
Rs14872781272,007,071TPH2
Rs14734731272,010,598TPH2
Rs14872761272,011,279TPH2
Rs171106901272,014,217TPH2
Rs14872751272,016,512TPH2
Rs13864861272,018,440TPH2
... further results
 On chromosomeChromosome positionIn geneSummary
Rs2060762750,461,686DDC
Rs3757472750,470,285DDC
Rs11761683750,475,181DDC
Rs11575461750,479,485DDC
Rs12718541750,482,446DDC
Rs1451371750,485,353DDC
Rs137853209(T;T)750,495,369DDCcommon in clinvar
Rs137853209750,495,369DDC
Rs137853212750,499,201DDC
Rs137853212(G;G)750,499,201DDCcommon in clinvar
Rs137853208(C;C)750,504,025DDCcommon in clinvar
Rs137853208750,504,025DDC
Rs6592961750,505,192DDC
Rs1470750750,508,950DDC
Rs3735273750,529,166DDC
Rs137853210750,529,339DDC
Rs137853210(A;A)750,529,339DDCcommon in clinvar
Rs998850750,539,690DDC
RGPD2
Rs137853207750,539,926DDC
DDC-AS1
Rs137853207(G;G)750,539,926DDC
DDC-AS1
common in clinvar
Rs137853211750,539,958DDC
DDC-AS1
Rs137853211(C;C)750,539,958DDC
DDC-AS1
common in clinvar
Rs7809234750,542,681DDC
DDC-AS1
Rs6264750,544,037DDC
Rs6264(G;G)750,544,037DDCcommon in complete genomics
Rs2044859750,544,864DDC
Rs11974297750,550,562DDC
Rs2329340750,552,531DDC
Rs1451375750,555,014DDC
Rs921451750,555,587DDC
Rs3837091750,561,043DDC
Rs12540874750,597,225GRB10

Serotonin degradation[edit]

 On chromosomeChromosome positionIn geneSummary
Rs5953210X43,654,798MAOA
Rs5906883X43,667,695MAOA
Rs1465107X43,678,769MAOA
Rs5906957X43,688,062MAOA
Rs909525(G;G)X43,693,955MAOAPerhaps MAOA 3 repeats: Warrior Gene?
Rs909525(A;G)X43,693,955MAOAProbably one Warrior Gene and one non-Warrior Gene.
Rs909525X43,693,955MAOABest proxy for Warrior Gene repeats.
Rs909525(A;A)X43,693,955MAOAProbably MAOA 4 or 5 repeats: not Warrior Gene.
Rs2283725X43,700,729MAOA
Rs587777457(G;G)X43,731,695MAOAcommon in clinvar
Rs587777457X43,731,695MAOA
Rs72554632(C;T)X43,731,784MAOACarrier for Brunner's Syndrome
Rs72554632(T;T)X43,731,784MAOApossible mental retardation
Rs72554632X43,731,784MAOA
Rs72554632(C;C)X43,731,784MAOAcommon in clinvar
Rs6323X43,731,789MAOAMonoamine oxidase A activity
Rs6323(G;G)X43,731,789MAOAIncreased monoamine oxidase A activity
Rs3027400X43,733,516MAOA
Rs2235186X43,736,181MAOA
Rs2072743X43,740,274MAOA
Rs979606X43,741,895MAOA
Rs1137070X43,744,144MAOA
Rs3027407X43,745,594MAOA
Rs3027409X43,747,786MAOA
Rs3027409(T;T)X43,747,786MAOAcommon on affy axiom data
Rs6609257X43,753,461MAOA

Serotonin transporters[edit]

 On chromosomeChromosome positionIn geneSummary
Rs38130341730,197,786SLC6A4
Rs1042173(T;T)1730,197,993SLC6A4among alcoholics, likely to be heavier drinkers
Rs10421731730,197,993SLC6A4
Rs1042173(G;G)1730,197,993SLC6A4normal
Rs1042173(G;T)1730,197,993SLC6A4normal
Rs124497831730,200,635SLC6A4
Rs37948081730,204,775SLC6A4
Rs343881961730,207,451SLC6A4
Rs28914832(A;A)1730,211,356SLC6A4common in complete genomics
Rs289148321730,211,356SLC6A4
Rs140701(A;A)1730,211,514SLC6A4Increased risk for anxiety disorders
Rs140701(A;G)1730,211,514SLC6A4Increased risk for anxiety disorders
Rs140701(G;G)1730,211,514SLC6A4Normal risk for anxiety disorders
Rs1407011730,211,514SLC6A4
Rs45833061730,211,697SLC6A4
Rs140700(C;C)1730,216,371SLC6A4
Rs1407001730,216,371SLC6A4
Rs20209421730,219,896SLC6A4
Rs2020942(A;G)1730,219,896SLC6A4common in complete genomics
Rs80760051730,220,192SLC6A4
Rs110801221730,220,317SLC6A4
Rs570983341730,221,570SLC6A4
Rs63541730,222,880SLC6A4
Rs255281730,222,960SLC6A4
Rs20209361730,223,796SLC6A4
Rs121502141730,223,870SLC6A4
Rs2066713(C;T)1730,224,647SLC6A4common in complete genomics
Rs20667131730,224,647SLC6A4
Rs4251417(G;G)1730,224,840SLC6A4
Rs42514171730,224,840SLC6A4
Rs80716671730,225,755SLC6A4
Rs169656281730,228,407SLC6A4
Rs20209341730,234,442SLC6A4
Rs20209331730,234,737SLC6A4
Rs2020933(T;T)1730,234,737SLC6A4
Rs25533(T;T)1730,235,874SLC6A4common in complete genomics
Rs255331730,235,874SLC6A4
Rs25532(C;C)1730,237,152SLC6A4may be part of a haplotype associated with OCD
Rs255321730,237,152SLC6A4
Rs25532(C;T)1730,237,152SLC6A4may be part of a haplotype associated with OCD
Rs25532(T;T)1730,237,152SLC6A4normal
Rs25531(A;A)1730,237,328SLC6A4short form of 5-HTTLPR. lower levels of serotonin, slightly less happy, benefits from more support
Rs255311730,237,328SLC6A4
Rs25531(-;-)1730,237,328SLC6A4
Rs25531(G;G)1730,237,328SLC6A4long form of 5-HTTLPR. less sensitive to pain
Rs4795541(AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG;AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG)1730,237,341SLC6A4complex; see details
Rs47955411730,237,341SLC6A4
Rs4795541(-;-)1730,237,341SLC6A4normal
Rs4795541(-;AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG)1730,237,341SLC6A4complex; see details
 On chromosomeChromosome positionIn geneSummary
Rs6091214310117,241,017SLC18A2
Rs363387(T;T)10117,244,053SLC18A2
Rs36338710117,244,053SLC18A2
Rs201558610117,262,226SLC18A2
Rs36322410117,263,062SLC18A2
Rs36322710117,267,055SLC18A2
Rs36327610117,274,298SLC18A2

Serotonin receptors[edit]

 On chromosomeChromosome positionIn geneSummary
Rs7445832563,290,474
Rs878567563,960,164HTR1A
Rs6449693563,960,191HTR1A
Rs34118353563,961,168HTR1A
Rs112846276563,961,175HTR1A
Rs6294563,961,426HTR1A
Rs367956927563,962,199HTR1A
Rs367956927(T;T)563,962,199HTR1Acommon in clinvar
Rs6295563,962,738HTR1A
Rs113195492563,962,787HTR1A
 On chromosomeChromosome positionIn geneSummary
Rs13212041677,461,407HTR1B
Rs13212041(C;C)677,461,407HTR1B
Rs6296677,462,543HTR1B
Rs130058677,463,564HTR1B
Rs11568817677,463,665HTR1B
Rs4140535677,465,335HTR1B
 On chromosomeChromosome positionIn geneSummary
Rs3828741687,015,956HTR1E
Rs3828741(C;C)687,015,956HTR1Ecommon in complete genomics
 On chromosomeChromosome positionIn geneSummary
Rs31251346,834,716HTR2A
Rs6314(C;T)1346,834,899HTR2Ahigher risk for RA; better response to paroxetine as treatment for depression
Rs6314(T;T)1346,834,899HTR2Aaverage
Rs63141346,834,899HTR2A
Rs6314(C;C)1346,834,899HTR2Ahigher risk for RA
Rs73223471346,835,968HTR2A
Rs7997012(A;A)1346,837,850HTR2A~18% more likely to respond to citalopram
Rs7997012(G;G)1346,837,850HTR2A~18% less likely to respond to citalopram
Rs7997012(A;G)1346,837,850HTR2Anormal risk
Rs79970121346,837,850HTR2A
Rs37422781346,845,442HTR2A
Rs65613331346,846,177HTR2A
Rs19238861346,849,156HTR2A
Rs17458371346,850,677HTR2A
HTR2A-AS1
Rs6558881346,854,046HTR2A
HTR2A-AS1
Rs22969721346,854,336HTR2A
HTR2A-AS1
Rs643627(T;C)1346,854,476HTR2A
HTR2A-AS1
Rs6436271346,854,476HTR2A
HTR2A-AS1
Rs7984966(C;C)1346,855,311HTR2A
HTR2A-AS1
ADHD in adults
Rs79849661346,855,311HTR2A
HTR2A-AS1
Rs22247211346,858,019HTR2A
Rs93162331346,859,220HTR2A
Rs27702921346,860,971HTR2A
Rs6597341346,861,148HTR2A
Rs659734(T;T)1346,861,148HTR2Acommon in complete genomics
Rs19280421346,863,081HTR2A
Rs27702961346,866,425HTR2A
Rs1328674(G;G)1346,867,572HTR2Aaverage
Rs13286741346,867,572HTR2A
Rs1328674(A;A)1346,867,572HTR2Ahigher risk for RA
Rs1328674(A;G)1346,867,572HTR2Ahigher risk for RA
Rs5823851346,871,859HTR2A
Rs19280401346,873,101HTR2A
Rs27703041346,881,230HTR2A
Rs9275441346,881,916HTR2A
Rs172887231346,883,558HTR2A
Rs594242(C;G)1346,883,917HTR2A
Rs5942421346,883,917HTR2A
Rs9534505(G;G)1346,886,609HTR2Acommon in complete genomics
Rs95345051346,886,609HTR2A
Rs20700371346,892,935HTR2A
Rs63131346,895,805HTR2A
Rs6313(C;C)1346,895,805HTR2Ahigher risk for RA
Rs6313(C;T)1346,895,805HTR2Ahigher risk for RA
Rs6313(T;T)1346,895,805HTR2Adepression, panic, stress response
Rs63111346,897,343HTR2A
Rs6311(T;T)1346,897,343HTR2ANormal (lower) risk of sexual dysfunction when taking SSRI Antidepressants.
Rs6311(C;C)1346,897,343HTR2A3.6x increased risk of sexual dysfunction when taking SSRI Antidepressants.
Rs6311(C;T)1346,897,343HTR2ANormal risk of sexual dysfunction when taking SSRI Antidepressants.
 On chromosomeChromosome positionIn geneSummary
Rs101947762231,115,305HTR2B
PSMD1
Rs168278012231,116,063HTR2B
PSMD1
Rs798745402231,123,707HTR2B
PSMD1
Rs79874540(C;C)2231,123,707HTR2B
PSMD1
common in complete genomics
Rs79874540(T;T)2231,123,707HTR2B
PSMD1
 On chromosomeChromosome positionIn geneSummary
Rs521018X114,583,441HTR2C
Rs498207X114,583,649HTR2C
Rs3813928X114,583,809HTR2C
Rs3813929(C;T)X114,584,047HTR2Cnormal
Rs3813929(T;T)X114,584,047HTR2Cnormal
Rs3813929X114,584,047HTR2C
Rs3813929(C;C)X114,584,047HTR2Cpossible weight gain if taking olanzapine
Rs518147(C;C)X114,584,109HTR2Cless weight gain if taking olanzapine
Rs518147X114,584,109HTR2C
Rs518147(C;G)X114,584,109HTR2Cnormal
Rs518147(G;G)X114,584,109HTR2Cnormal
Rs498177X114,590,222HTR2C
Rs6318(C;G)X114,731,326HTR2CFemale only, since on X ch; appears to mostly be = to common (G;G) genotype
Rs6318(C;C)X114,731,326HTR2C1.4x increased risk for cardiac events in patients; apparently stress (cortisol) related
Rs6318X114,731,326HTR2C
Rs6318(G;G)X114,731,326HTR2Ccommon in clinvar
Rs1414334X114,903,581HTR2C
Rs1414334(C;C)X114,903,581HTR2Cassociated with metabolic syndrome when taking antipsychotics
 On chromosomeChromosome positionIn geneSummary
Rs115022611113,974,819HTR3A
Rs1150226(C;C)11113,974,819HTR3Acommon in complete genomics
Rs106261311113,975,284HTR3A
Rs3394020811113,975,355HTR3A
Rs198524211113,977,551HTR3A
Rs227630211113,979,418HTR3A
Rs1016054811113,985,959HTR3A
Rs117671311113,989,703HTR3A
 On chromosomeChromosome positionIn geneSummary
Rs1078997011113,903,224HTR3B
Rs375898711113,904,553HTR3B
Rs45460698(AAG;AAG)11113,904,832HTR3B
Rs4546069811113,904,832HTR3B
Rs11606194(T;T)11113,910,259HTR3B
Rs1160619411113,910,259HTR3B
Rs117674411113,932,306HTR3B
Rs227630511113,932,382HTR3B
Rs227630711113,933,165HTR3B
Rs2276307(A;A)11113,933,165HTR3B
Rs378202511113,936,885HTR3B
Rs167271711113,942,011HTR3B
 On chromosomeChromosome positionIn geneSummary
Rs118203884(T;T)MT4,409HTR3Ccommon in clinvar
Rs118203884MT4,409HTR3C
Rs67664103184,056,974HTR3C
Rs6807362(C;C)3184,060,222HTR3Cincreased autism risk
Rs6807362(G;G)3184,060,222HTR3Cdecreased autism risk
Rs68073623184,060,222HTR3C
Rs6807362(C;G)3184,060,222HTR3Cnormal autism risk
Rs68076703184,060,510HTR3C
Rs3981246463185,254,016EHHADH
MIR5588
Rs398124646(G;G)3185,254,016EHHADH
MIR5588
common in clinvar
 On chromosomeChromosome positionIn geneSummary
Rs64439303184,036,506HTR3D
 On chromosomeChromosome positionIn geneSummary
Rs76276153184,100,628HTR3E
Rs561098473184,106,769HTR3E
Rs56109847(G;G)3184,106,769HTR3Ecommon in complete genomics
Rs626250443184,106,769HTR3E
 On chromosomeChromosome positionIn geneSummary
Rs515726208(G;G)5147,824,702SPINK1common in clinvar
Rs5157262085147,824,702SPINK1
Rs1489543875147,828,020SPINK1
Rs148954387(A;A)5147,828,020SPINK1common in clinvar
Rs5157262075147,828,056SPINK1
Rs515726207(A;A)5147,828,056SPINK1common in clinvar
Rs5157262065147,828,066SPINK1
Rs515726206(A;A)5147,828,066SPINK1common in clinvar
Rs17107315(C;C)5147,828,115SPINK1risk of pancreatitis
Rs171073155147,828,115SPINK1
Rs17107315(T;T)5147,828,115SPINK1normal
Rs17107315(C;T)5147,828,115SPINK1risk of pancreatitis
Rs104893939(T;T)5147,831,537SPINK1common in clinvar
Rs1048939395147,831,537SPINK1
Rs1939226595147,831,551SPINK1
Rs193922659(C;C)5147,831,551SPINK1common in clinvar
Rs289357685147,831,576SPINK1
Rs28935768(T;T)5147,831,576SPINK1
Rs1048939385147,831,576SPINK1
Rs104893938(T;T)5147,831,576SPINK1common in clinvar
Rs8919925147,845,951
Rs111680485148,462,790HTR4
Rs39950905148,466,252HTR4
Rs77330885148,476,770HTR4
Rs93251045148,543,814HTR4
 On chromosomeChromosome positionIn geneSummary
Rs10239794(C;C)7154,508,809DPP6average
Rs10239794(C;T)7154,508,809DPP61.3x risk for ALS
Rs102397947154,508,809DPP6
Rs10239794(T;T)7154,508,809DPP6>1.3x risk for ALS
Rs18008837155,070,881DOPEY1
HTR5A
Rs63207155,070,911HTR5A
HTR5AOS
 On chromosomeChromosome positionIn geneSummary
Rs1805054(C;C)119,666,020HTR6common in complete genomics
Rs1805054119,666,020HTR6
Rs4654903119,874,497
 On chromosomeChromosome positionIn geneSummary
Rs122493771090,833,199HTR7
Rs19353491090,834,586HTR7
Rs111870331092,502,602IDE
Rs18321961092,508,577IDE
Rs78958321092,516,769IDE
Rs7895832(A;A)1092,516,769IDEcommon in complete genomics
Rs70784131092,530,727IDE
Rs111870611092,545,652IDE
Rs17107734(C;C)1092,545,660IDEcommon in complete genomics
Rs171077341092,545,660IDE
Rs111870651092,552,167IDE
Rs19997641092,560,382IDE
Rs46469541092,574,070IDE
Rs4646954(G;G)1092,574,070IDEcommon in complete genomics
Rs46469531092,574,198IDE
Rs3758505(T;T)1092,575,021IDEcommon in complete genomics
Rs37585051092,575,021IDE
Rs65838261092,588,073