Serotonin/all

From SNPedia
Jump to: navigation, search

Serotonin synthesis[edit]

  On chromosome Chromosome position In gene Summary
Rs2108977 11 18,019,049 TPH1
Rs7933505 11 18,024,440 TPH1
Rs1799913 11 18,025,708 TPH1 heroin addiction in hispanics
Rs1800532 11 18,026,269 TPH1
Rs211105 11 18,033,757 TPH1
Rs1799913(C;C) 11 18,047,255 TPH1 Hispanics may be at increased risk of heroin addiction.
  On chromosome Chromosome position In gene Summary
Rs4489789 12 70,665,152 PTPRR
Rs2175711 12 70,679,733 PTPRR
Rs2203231 12 70,686,988 PTPRR
Rs4570625 12 71,938,143 TPH2
Rs11178997 12 71,938,373 TPH2
Rs11178998 12 71,938,935 TPH2
Rs4341581 12 71,941,293 TPH2
Rs7954758 12 71,942,014 TPH2
Rs10748185 12 71,942,075 TPH2
Rs4565946 12 71,942,989 TPH2
Rs11179000 12 71,944,848 TPH2
Rs11179002 12 71,948,504 TPH2
Rs1843809 12 71,954,918 TPH2
Rs7955501 12 71,956,246 TPH2
Rs1386496 12 71,957,010 TPH2
Rs1386494 12 71,958,763 TPH2
Rs1386493 12 71,961,399 TPH2
Rs2171363 12 71,966,484 TPH2
Rs7963720 12 71,972,406 TPH2
Rs17110563 12 71,972,526 TPH2
Rs4760816 12 71,978,821 TPH2
Rs120074176 12 71,979,053 TPH2
Rs7305115 12 71,979,082 TPH2
Rs7305115(A;A) 12 71,979,082 TPH2 Individuals showed a significantly lower risk of suicide behavior than those with the A/G or G/G genotype
Rs11179027 12 71,983,532 TPH2
Rs10506645 12 71,991,720 TPH2
Rs1007023 12 71,994,594 TPH2
Rs4760820 12 72,003,216 TPH2
Rs1386498 12 72,004,363 TPH2
Rs1487278 12 72,007,071 TPH2
Rs1473473 12 72,010,598 TPH2
Rs1487276 12 72,011,279 TPH2
Rs17110690 12 72,014,217 TPH2
Rs1487275 12 72,016,512 TPH2
Rs1386486 12 72,018,440 TPH2
Rs1386483 12 72,018,714 TPH2
Rs1386482 12 72,018,792 TPH2
Rs10879357 12 72,020,783 TPH2
Rs4469933 12 72,020,937 TPH2
Rs11615016 12 72,022,214 TPH2
Rs4290270 12 72,022,455 TPH2
Rs120074175 12 72,031,544 TPH2
Rs17110747 12 72,032,174 TPH2
Rs4570625(G;G) 12 72,331,923 TPH2 higher scores on anxiety-related personality traits; greater placebo response
Rs11178998(A;A) 12 72,332,715 TPH2
Rs120074176(C;C) 12 72,372,833 TPH2 common in complete genomics
Rs7305115(A;G) 12 72,372,862 TPH2 risk of suicide behavior
Rs7305115(G;G) 12 72,372,862 TPH2 risk of suicide behavior
Rs120074175(G;G) 12 72,425,324 TPH2 common in complete genomics
Rs17110747(G;G) 12 72,425,954 TPH2 common in complete genomics
  On chromosome Chromosome position In gene Summary
Rs2060762 7 50,461,686 DDC
Rs3757472 7 50,470,285 DDC
Rs11761683 7 50,475,181 DDC
Rs11575461 7 50,479,485 DDC
Rs12718541 7 50,482,446 DDC
Rs1451371 7 50,485,353 DDC
Rs137853209 7 50,495,369 DDC
Rs137853212 7 50,499,201 DDC
Rs137853208 7 50,504,025 DDC
Rs6592961 7 50,505,192 DDC
Rs1470750 7 50,508,950 DDC
Rs3735273 7 50,529,166 DDC
Rs137853210 7 50,529,339 DDC
Rs998850 7 50,539,690 DDC
RGPD2
Rs137853207 7 50,539,926 DDC
AC018705.5
Rs137853211 7 50,539,958 DDC
AC018705.5
Rs6264 7 50,544,037 DDC
Rs2044859 7 50,544,864 DDC
Rs11974297 7 50,550,562 DDC
Rs2329340 7 50,552,531 DDC
Rs1451375 7 50,555,014 DDC
Rs921451 7 50,555,587 DDC
Rs137853209(T;T) 7 50,563,067 DDC common in clinvar
Rs137853212(G;G) 7 50,566,899 DDC common in clinvar
Rs137853208(C;C) 7 50,571,723 DDC common in clinvar
Rs137853210(A;A) 7 50,597,037 DDC common in clinvar
Rs12540874 7 50,597,225 GRB10
Rs137853207(G;G) 7 50,607,624 DDC
LOC100129427
common in clinvar
Rs137853211(C;C) 7 50,607,656 DDC
LOC100129427
common in clinvar
Rs6264(G;G) 7 50,611,735 DDC common in complete genomics

Serotonin degradation[edit]

  On chromosome Chromosome position In gene Summary
Rs909525(A;G) X 43,553,202 MAOA Probably one Warrior Gene and one non-Warrior Gene.
Rs909525(A;A) X 43,553,202 MAOA Probably MAOA 4 or 5 repeats: not Warrior Gene.
Rs909525(G;G) X 43,553,202 MAOA Perhaps MAOA 3 repeats: Warrior Gene?
Rs72554632(T;T) X 43,591,031 MAOA possible mental retardation
Rs72554632(C;C) X 43,591,031 MAOA common in clinvar
Rs3027409(T;T) X 43,607,033 MAOA common on affy axiom data
Rs5953210 X 43,654,798 MAOA
Rs5906883 X 43,667,695 MAOA
Rs1465107 X 43,678,769 MAOA
Rs5906957 X 43,688,062 MAOA
Rs909525 X 43,693,955 MAOA Best proxy for Warrior Gene repeats.
Rs2283725 X 43,700,729 MAOA
Rs72554632 X 43,731,784 MAOA
Rs6323 X 43,731,789 MAOA
Rs6323(G;G) X 43,731,789 MAOA
Rs3027400 X 43,733,516 MAOA
Rs2235186 X 43,736,181 MAOA
Rs2072743 X 43,740,274 MAOA
Rs979606 X 43,741,895 MAOA
Rs1137070 X 43,744,144 MAOA
Rs3027407 X 43,745,594 MAOA
Rs3027409 X 43,747,786 MAOA
Rs6609257 X 43,753,461 MAOA

Serotonin transporters[edit]

  On chromosome Chromosome position In gene Summary
Rs1042173(G;T) 17 28,525,011 SLC6A4 normal
Rs1042173(T;T) 17 28,525,011 SLC6A4 among alcoholics, likely to be heavier drinkers
Rs1042173(G;G) 17 28,525,011 SLC6A4 normal
Rs28914832(A;A) 17 28,538,374 SLC6A4 common in complete genomics
Rs140701(A;A) 17 28,538,532 SLC6A4 Increased risk for anxiety disorders
Rs140701(A;G) 17 28,538,532 SLC6A4 Increased risk for anxiety disorders
Rs140701(G;G) 17 28,538,532 SLC6A4 Normal risk for anxiety disorders
Rs2020942(A;G) 17 28,546,914 SLC6A4 common in complete genomics
Rs2066713(C;T) 17 28,551,665 SLC6A4 common in complete genomics
Rs4251417(G;G) 17 28,551,858 SLC6A4
Rs25533(T;T) 17 28,562,892 SLC6A4 common in complete genomics
Rs25532(T;T) 17 28,564,170 SLC6A4 normal
Rs25532(C;C) 17 28,564,170 SLC6A4 may be part of a haplotype associated with OCD
Rs25532(C;T) 17 28,564,170 SLC6A4 may be part of a haplotype associated with OCD
Rs25531(-;-) 17 28,564,346 SLC6A4
Rs25531(G;G) 17 28,564,346 SLC6A4 long form of 5-HTTLPR. less sensitive to pain
Rs4795541(-;AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG) 17 28,564,359 SLC6A4 complex; see details
Rs4795541(AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG;AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG) 17 28,564,359 SLC6A4 complex; see details
Rs4795541(-;-) 17 28,564,359 SLC6A4 normal
Rs3813034 17 30,197,786 SLC6A4
Rs1042173 17 30,197,993 SLC6A4
Rs12449783 17 30,200,635 SLC6A4
Rs3794808 17 30,204,775 SLC6A4
Rs34388196 17 30,207,451 SLC6A4
Rs28914832 17 30,211,356 SLC6A4
Rs140701 17 30,211,514 SLC6A4
Rs4583306 17 30,211,697 SLC6A4
Rs140700 17 30,216,371 SLC6A4
Rs2020942 17 30,219,896 SLC6A4
Rs8076005 17 30,220,192 SLC6A4
Rs11080122 17 30,220,317 SLC6A4
Rs57098334 17 30,221,570 SLC6A4
Rs6354 17 30,222,880 SLC6A4
Rs25528 17 30,222,960 SLC6A4
Rs2020936 17 30,223,796 SLC6A4
Rs12150214 17 30,223,870 SLC6A4
Rs2066713 17 30,224,647 SLC6A4
Rs4251417 17 30,224,840 SLC6A4
Rs8071667 17 30,225,755 SLC6A4
Rs16965628 17 30,228,407 SLC6A4
Rs2020934 17 30,234,442 SLC6A4
Rs2020933 17 30,234,737 SLC6A4
Rs25533 17 30,235,874 SLC6A4
Rs25532 17 30,237,152 SLC6A4
Rs25531 17 30,237,328 SLC6A4
Rs4795541 17 30,237,341 SLC6A4
  On chromosome Chromosome position In gene Summary
Rs60912143 10 119,000,528 SLC18A2
Rs363387 10 119,003,564 SLC18A2
Rs2015586 10 119,021,737 SLC18A2
Rs363224 10 119,022,573 SLC18A2
Rs363227 10 119,026,566 SLC18A2
Rs363276 10 119,033,809 SLC18A2

Serotonin receptors[edit]

  On chromosome Chromosome position In gene Summary
Rs7445832 5 63,290,474
Rs878567 5 63,960,164 HTR1A
Rs6449693 5 63,960,191 HTR1A
Rs34118353 5 63,961,168 HTR1A
Rs112846276 5 63,961,175 HTR1A
Rs6294 5 63,961,426 HTR1A
Rs6295 5 63,962,738 HTR1A
Rs113195492 5 63,962,787 HTR1A
  On chromosome Chromosome position In gene Summary
Rs13212041 6 77,461,407 HTR1B
Rs6296 6 77,462,543 HTR1B
Rs130058 6 77,463,564 HTR1B
Rs11568817 6 77,463,665 HTR1B
Rs4140535 6 77,465,335 HTR1B
Rs13212041(C;C) 6 78,171,124 HTR1B
  On chromosome Chromosome position In gene Summary
Rs3828741 6 87,015,956 HTR1E
Rs3828741(C;C) 6 87,725,674 HTR1E common in complete genomics
  On chromosome Chromosome position In gene Summary
Rs3125 13 46,834,716 HTR2A
Rs6314 13 46,834,899 HTR2A
Rs7322347 13 46,835,968 HTR2A
Rs7997012 13 46,837,850 HTR2A
Rs3742278 13 46,845,442 HTR2A
Rs1923886 13 46,849,156 HTR2A
Rs1745837 13 46,850,677 HTR2A
HTR2A-AS1
Rs655888 13 46,854,046 HTR2A
HTR2A-AS1
Rs2296972 13 46,854,336 HTR2A
HTR2A-AS1
Rs643627 13 46,854,476 HTR2A
HTR2A-AS1
Rs7984966 13 46,855,311 HTR2A
HTR2A-AS1
Rs2224721 13 46,858,019 HTR2A
Rs9316233 13 46,859,220 HTR2A
Rs2770292 13 46,860,971 HTR2A
Rs659734 13 46,861,148 HTR2A
Rs1928042 13 46,863,081 HTR2A
Rs2770296 13 46,866,425 HTR2A
Rs1328674 13 46,867,572 HTR2A
Rs582385 13 46,871,859 HTR2A
Rs1928040 13 46,873,101 HTR2A
Rs2770304 13 46,881,230 HTR2A
Rs927544 13 46,881,916 HTR2A
Rs17288723 13 46,883,558 HTR2A
Rs594242 13 46,883,917 HTR2A
Rs9534505 13 46,886,609 HTR2A
Rs2070037 13 46,892,935 HTR2A
Rs6313 13 46,895,805 HTR2A
Rs6311 13 46,897,343 HTR2A
Rs6314(C;C) 13 47,409,034 HTR2A higher risk for RA
Rs7997012(G;G) 13 47,411,985 HTR2A ~18% less likely to respond to citalopram
Rs7997012(A;A) 13 47,411,985 HTR2A ~18% more likely to respond to citalopram
Rs7984966(C;C) 13 47,429,446 HTR2A ADHD in adults
Rs659734(T;T) 13 47,435,283 HTR2A common in complete genomics
Rs9534505(G;G) 13 47,460,744 HTR2A common in complete genomics
Rs6313(T;T) 13 47,469,940 HTR2A depression, panic, stress response
Rs6311(C;T) 13 47,471,478 HTR2A Normal risk of sexual dysfunction when taking SSRI Antidepressants.
Rs6311(T;T) 13 47,471,478 HTR2A Normal (lower) risk of sexual dysfunction when taking SSRI Antidepressants.
Rs6311(C;C) 13 47,471,478 HTR2A 3.6x increased risk of sexual dysfunction when taking SSRI Antidepressants.
  On chromosome Chromosome position In gene Summary
Rs10194776 2 231,115,305 HTR2B
PSMD1
Rs16827801 2 231,116,063 HTR2B
PSMD1
Rs79874540 2 231,123,707 HTR2B
PSMD1
Rs79874540(T;T) 2 231,988,421 HTR2B
PSMD1
Rs79874540(C;C) 2 231,988,421 HTR2B
PSMD1
common in complete genomics
  On chromosome Chromosome position In gene Summary
Rs3813929(T;T) X 113,818,520 HTR2C normal
Rs3813929(C;C) X 113,818,520 HTR2C possible weight gain if taking olanzapine
Rs3813929(C;T) X 113,818,520 HTR2C normal
Rs518147(C;G) X 113,818,582 HTR2C normal
Rs518147(G;G) X 113,818,582 HTR2C normal
Rs518147(C;C) X 113,818,582 HTR2C less weight gain if taking olanzapine
Rs6318(C;G) X 113,965,735 HTR2C Female only, since on X ch; appears to mostly be = to common (G;G) genotype
Rs6318(C;C) X 113,965,735 HTR2C 1.4x increased risk for cardiac events in patients; apparently stress (cortisol) related
Rs1414334(C;C) X 114,138,144 HTR2C associated with metabolic syndrome when taking antipsychotics
Rs521018 X 114,583,441 HTR2C
Rs498207 X 114,583,649 HTR2C
Rs3813928 X 114,583,809 HTR2C
Rs3813929 X 114,584,047 HTR2C
Rs518147 X 114,584,109 HTR2C
Rs498177 X 114,590,222 HTR2C
Rs6318 X 114,731,326 HTR2C
Rs1414334 X 114,903,581 HTR2C
  On chromosome Chromosome position In gene Summary
Rs1150226(C;C) 11 113,845,541 HTR3A common in complete genomics
Rs1150226 11 113,974,819 HTR3A
Rs1062613 11 113,975,284 HTR3A
Rs33940208 11 113,975,355 HTR3A
Rs1985242 11 113,977,551 HTR3A
Rs2276302 11 113,979,418 HTR3A
Rs10160548 11 113,985,959 HTR3A
Rs1176713 11 113,989,703 HTR3A
  On chromosome Chromosome position In gene Summary
Rs6277(C;T) 11 113,283,459 DRD2 1.4x higher schizophrenia risk
Rs6277(T;T) 11 113,283,459 DRD2 normal schizophrenia risk, learns NoGo faster
Rs6277(C;C) 11 113,283,459 DRD2 1.6x higher schizophrenia risk
Rs1800496(C;C) 11 113,283,488 DRD2 common in complete genomics
Rs104894220(G;G) 11 113,287,657 DRD2 common in clinvar
Rs11214606(C;C) 11 113,309,869 DRD2 common on affy axiom data
Rs45460698(AAG;AAG) 11 113,775,554 HTR3B
Rs2276307(A;A) 11 113,803,887 HTR3B
Rs10789970 11 113,903,224 HTR3B
Rs3758987 11 113,904,553 HTR3B
Rs45460698 11 113,904,832 HTR3B
Rs11606194 11 113,910,259 HTR3B
Rs1176744 11 113,932,306 HTR3B
Rs2276305 11 113,932,382 HTR3B
Rs2276307 11 113,933,165 HTR3B
Rs3782025 11 113,936,885 HTR3B
Rs1672717 11 113,942,011 HTR3B
  On chromosome Chromosome position In gene Summary
Rs118203884 MT 4,409 HTR3C
Rs6807362(G;G) 3 183,778,010 HTR3C decreased autism risk
Rs6807362(C;G) 3 183,778,010 HTR3C normal autism risk
Rs6807362(C;C) 3 183,778,010 HTR3C increased autism risk
Rs6766410 3 184,056,974 HTR3C
Rs6807362 3 184,060,222 HTR3C
Rs6807670 3 184,060,510 HTR3C
Rs398124646 3 185,254,016 EHHADH
  On chromosome Chromosome position In gene Summary
Rs6443930 3 184,036,506 HTR3D
  On chromosome Chromosome position In gene Summary
Rs56109847(G;G) 3 183,824,557 HTR3E common in complete genomics
Rs7627615 3 184,100,628 HTR3E
Rs56109847 3 184,106,769 HTR3E
Rs62625044 3 184,106,769 HTR3E
  On chromosome Chromosome position In gene Summary
Rs17107315 5 147,828,115 SPINK1
Rs104893939 5 147,831,537 SPINK1
Rs193922659 5 147,831,551 SPINK1
Rs28935768 5 147,831,576 SPINK1
Rs104893938 5 147,831,576 SPINK1
Rs11168048 5 148,462,790 HTR4
Rs3995090 5 148,466,252 HTR4
Rs7733088 5 148,476,770 HTR4
Rs9325104 5 148,543,814 HTR4
  On chromosome Chromosome position In gene Summary
Rs10239794 7 154,508,809 DPP6
Rs1800883 7 155,070,881 DOPEY1
HTR5A
Rs6320 7 155,070,911 HTR5A
HTR5AOS
  On chromosome Chromosome position In gene Summary
Rs1805054 1 19,666,020 HTR6
Rs4654903 1 19,874,497
Rs1805054(C;C) 1 19,992,513 HTR6 common in complete genomics
  On chromosome Chromosome position In gene Summary
Rs1935349 10 92,594,343 HTR7