Serotonin/all

From SNPedia
Jump to: navigation, search

Serotonin synthesis[edit]

 On chromosomeChromosome positionIn geneSummary
Rs3665901116,850,893PLEKHA7
Rs21089771118,019,049TPH1
Rs79335051118,024,440TPH1
Rs17999131118,025,708TPH1heroin addiction in hispanics
Rs18005321118,026,269TPH1
Rs2111051118,033,757TPH1
Rs6843021118,038,806TPH1
Rs1799913(C;C)1118,047,255TPH1Hispanics may be at increased risk of heroin addiction.
 On chromosomeChromosome positionIn geneSummary
Rs44897891270,665,152PTPRR
Rs21757111270,679,733PTPRR
Rs22032311270,686,988PTPRR
Rs4570625(G;G)1271,938,143TPH2higher scores on anxiety-related personality traits; greater placebo response
Rs45706251271,938,143TPH2
Rs111789971271,938,373TPH2
Rs111789981271,938,935TPH2
Rs43415811271,941,293TPH2
Rs79547581271,942,014TPH2
Rs107481851271,942,075TPH2
Rs45659461271,942,989TPH2
Rs4565946(C;C)1271,942,989TPH2Risk of early-onset OCD
Rs111790001271,944,848TPH2
Rs111790021271,948,504TPH2
Rs18438091271,954,918TPH2
Rs79555011271,956,246TPH2
Rs13864961271,957,010TPH2
Rs13864941271,958,763TPH2
Rs13864931271,961,399TPH2
Rs21713631271,966,484TPH2
Rs79637201271,972,406TPH2
Rs171105631271,972,526TPH2
Rs47608161271,978,821TPH2
Rs1200741761271,979,053TPH2
Rs73051151271,979,082TPH2
Rs7305115(A;A)1271,979,082TPH2Individuals showed a significantly lower risk of suicide behavior than those with the A/G or G/G genotype
Rs111790271271,983,532TPH2
Rs105066451271,991,720TPH2
Rs10070231271,994,594TPH2
Rs47608201272,003,216TPH2
Rs13864981272,004,363TPH2
Rs14872781272,007,071TPH2
Rs14734731272,010,598TPH2
Rs14872761272,011,279TPH2
Rs171106901272,014,217TPH2
Rs14872751272,016,512TPH2
Rs13864861272,018,440TPH2
Rs13864831272,018,714TPH2
Rs13864821272,018,792TPH2
Rs108793571272,020,783TPH2
Rs44699331272,020,937TPH2
Rs116150161272,022,214TPH2
Rs42902701272,022,455TPH2
Rs1200741751272,031,544TPH2
Rs171107471272,032,174TPH2
Rs11178998(A;A)1272,332,715TPH2
Rs120074176(C;C)1272,372,833TPH2common in complete genomics
Rs7305115(G;G)1272,372,862TPH2risk of suicide behavior
Rs7305115(A;G)1272,372,862TPH2risk of suicide behavior
Rs120074175(G;G)1272,425,324TPH2common in complete genomics
... further results
 On chromosomeChromosome positionIn geneSummary
Rs2060762750,461,686DDC
Rs3757472750,470,285DDC
Rs11761683750,475,181DDC
Rs11575461750,479,485DDC
Rs12718541750,482,446DDC
Rs1451371750,485,353DDC
Rs137853209750,495,369DDC
Rs137853212750,499,201DDC
Rs137853208750,504,025DDC
Rs6592961750,505,192DDC
Rs1470750750,508,950DDC
Rs3735273750,529,166DDC
Rs137853210750,529,339DDC
Rs998850750,539,690DDC
RGPD2
Rs137853207750,539,926DDC
AC018705.5
Rs137853211750,539,958DDC
AC018705.5
Rs6264750,544,037DDC
Rs2044859750,544,864DDC
Rs11974297750,550,562DDC
Rs2329340750,552,531DDC
Rs1451375750,555,014DDC
Rs921451750,555,587DDC
Rs137853209(T;T)750,563,067DDCcommon in clinvar
Rs137853212(G;G)750,566,899DDCcommon in clinvar
Rs137853208(C;C)750,571,723DDCcommon in clinvar
Rs137853210(A;A)750,597,037DDCcommon in clinvar
Rs12540874750,597,225GRB10
Rs137853207(G;G)750,607,624DDC
LOC100129427
common in clinvar
Rs137853211(C;C)750,607,656DDC
LOC100129427
common in clinvar
Rs6264(G;G)750,611,735DDCcommon in complete genomics

Serotonin degradation[edit]

 On chromosomeChromosome positionIn geneSummary
Rs909525(A;G)X43,553,202MAOAProbably one Warrior Gene and one non-Warrior Gene.
Rs909525(A;A)X43,553,202MAOAProbably MAOA 4 or 5 repeats: not Warrior Gene.
Rs909525(G;G)X43,553,202MAOAPerhaps MAOA 3 repeats: Warrior Gene?
Rs72554632(T;T)X43,591,031MAOApossible mental retardation
Rs72554632(C;C)X43,591,031MAOAcommon in clinvar
Rs3027409(T;T)X43,607,033MAOAcommon on affy axiom data
Rs5953210X43,654,798MAOA
Rs5906883X43,667,695MAOA
Rs1465107X43,678,769MAOA
Rs5906957X43,688,062MAOA
Rs909525X43,693,955MAOABest proxy for Warrior Gene repeats.
Rs2283725X43,700,729MAOA
Rs72554632X43,731,784MAOA
Rs6323X43,731,789MAOA
Rs6323(G;G)X43,731,789MAOA
Rs3027400X43,733,516MAOA
Rs2235186X43,736,181MAOA
Rs2072743X43,740,274MAOA
Rs979606X43,741,895MAOA
Rs1137070X43,744,144MAOA
Rs3027407X43,745,594MAOA
Rs3027409X43,747,786MAOA
Rs6609257X43,753,461MAOA

Serotonin transporters[edit]

 On chromosomeChromosome positionIn geneSummary
Rs1042173(G;T)1728,525,011SLC6A4normal
Rs1042173(G;G)1728,525,011SLC6A4normal
Rs28914832(A;A)1728,538,374SLC6A4common in complete genomics
Rs140701(A;A)1728,538,532SLC6A4Increased risk for anxiety disorders
Rs140701(A;G)1728,538,532SLC6A4Increased risk for anxiety disorders
Rs140701(G;G)1728,538,532SLC6A4Normal risk for anxiety disorders
Rs2020942(A;G)1728,546,914SLC6A4common in complete genomics
Rs2066713(C;T)1728,551,665SLC6A4common in complete genomics
Rs4251417(G;G)1728,551,858SLC6A4
Rs25533(T;T)1728,562,892SLC6A4common in complete genomics
Rs25532(T;T)1728,564,170SLC6A4normal
Rs25532(C;C)1728,564,170SLC6A4may be part of a haplotype associated with OCD
Rs25532(C;T)1728,564,170SLC6A4may be part of a haplotype associated with OCD
Rs25531(-;-)1728,564,346SLC6A4
Rs4795541(-;AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG)1728,564,359SLC6A4complex; see details
Rs4795541(AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG;AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG)1728,564,359SLC6A4complex; see details
Rs4795541(-;-)1728,564,359SLC6A4normal
Rs38130341730,197,786SLC6A4
Rs10421731730,197,993SLC6A4
Rs1042173(T;T)1730,197,993SLC6A4among alcoholics, likely to be heavier drinkers
Rs124497831730,200,635SLC6A4
Rs37948081730,204,775SLC6A4
Rs343881961730,207,451SLC6A4
Rs289148321730,211,356SLC6A4
Rs1407011730,211,514SLC6A4
Rs45833061730,211,697SLC6A4
Rs1407001730,216,371SLC6A4
Rs20209421730,219,896SLC6A4
Rs80760051730,220,192SLC6A4
Rs110801221730,220,317SLC6A4
Rs570983341730,221,570SLC6A4
Rs63541730,222,880SLC6A4
Rs255281730,222,960SLC6A4
Rs20209361730,223,796SLC6A4
Rs121502141730,223,870SLC6A4
Rs20667131730,224,647SLC6A4
Rs42514171730,224,840SLC6A4
Rs80716671730,225,755SLC6A4
Rs169656281730,228,407SLC6A4
Rs20209341730,234,442SLC6A4
Rs20209331730,234,737SLC6A4
Rs255331730,235,874SLC6A4
Rs255321730,237,152SLC6A4
Rs255311730,237,328SLC6A4
Rs25531(G;G)1730,237,328SLC6A4long form of 5-HTTLPR. less sensitive to pain
Rs47955411730,237,341SLC6A4
 On chromosomeChromosome positionIn geneSummary
Rs6091214310119,000,528SLC18A2
Rs36338710119,003,564SLC18A2
Rs201558610119,021,737SLC18A2
Rs36322410119,022,573SLC18A2
Rs36322710119,026,566SLC18A2
Rs36327610119,033,809SLC18A2

Serotonin receptors[edit]

 On chromosomeChromosome positionIn geneSummary
Rs7445832563,290,474
Rs878567563,960,164HTR1A
Rs6449693563,960,191HTR1A
Rs34118353563,961,168HTR1A
Rs112846276563,961,175HTR1A
Rs6294563,961,426HTR1A
Rs6295563,962,738HTR1A
Rs113195492563,962,787HTR1A
 On chromosomeChromosome positionIn geneSummary
Rs13212041677,461,407HTR1B
Rs6296677,462,543HTR1B
Rs130058677,463,564HTR1B
Rs11568817677,463,665HTR1B
Rs4140535677,465,335HTR1B
Rs13212041(C;C)678,171,124HTR1B
 On chromosomeChromosome positionIn geneSummary
Rs3828741687,015,956HTR1E
Rs3828741(C;C)687,725,674HTR1Ecommon in complete genomics
 On chromosomeChromosome positionIn geneSummary
Rs31251346,834,716HTR2A
Rs63141346,834,899HTR2A
Rs73223471346,835,968HTR2A
Rs79970121346,837,850HTR2A
Rs37422781346,845,442HTR2A
Rs65613331346,846,177HTR2A
Rs19238861346,849,156HTR2A
Rs17458371346,850,677HTR2A
HTR2A-AS1
Rs6558881346,854,046HTR2A
HTR2A-AS1
Rs22969721346,854,336HTR2A
HTR2A-AS1
Rs6436271346,854,476HTR2A
HTR2A-AS1
Rs79849661346,855,311HTR2A
HTR2A-AS1
Rs22247211346,858,019HTR2A
Rs93162331346,859,220HTR2A
Rs27702921346,860,971HTR2A
Rs6597341346,861,148HTR2A
Rs19280421346,863,081HTR2A
Rs27702961346,866,425HTR2A
Rs13286741346,867,572HTR2A
Rs5823851346,871,859HTR2A
Rs19280401346,873,101HTR2A
Rs27703041346,881,230HTR2A
Rs9275441346,881,916HTR2A
Rs172887231346,883,558HTR2A
Rs5942421346,883,917HTR2A
Rs95345051346,886,609HTR2A
Rs20700371346,892,935HTR2A
Rs63131346,895,805HTR2A
Rs6313(C;C)1346,895,805HTR2Ahigher risk for RA
Rs6313(C;T)1346,895,805HTR2Ahigher risk for RA
Rs63111346,897,343HTR2A
Rs6311(C;C)1346,897,343HTR2A3.6x increased risk of sexual dysfunction when taking SSRI Antidepressants.
Rs6314(C;C)1347,409,034HTR2Ahigher risk for RA
Rs7997012(G;G)1347,411,985HTR2A~18% less likely to respond to citalopram
Rs7997012(A;A)1347,411,985HTR2A~18% more likely to respond to citalopram
Rs7984966(C;C)1347,429,446HTR2AADHD in adults
Rs659734(T;T)1347,435,283HTR2Acommon in complete genomics
Rs9534505(G;G)1347,460,744HTR2Acommon in complete genomics
Rs6313(T;T)1347,469,940HTR2Adepression, panic, stress response
Rs6311(C;T)1347,471,478HTR2ANormal risk of sexual dysfunction when taking SSRI Antidepressants.
Rs6311(T;T)1347,471,478HTR2ANormal (lower) risk of sexual dysfunction when taking SSRI Antidepressants.
 On chromosomeChromosome positionIn geneSummary
Rs101947762231,115,305HTR2B
PSMD1
Rs168278012231,116,063HTR2B
PSMD1
Rs798745402231,123,707HTR2B
PSMD1
Rs79874540(T;T)2231,988,421HTR2B
PSMD1
Rs79874540(C;C)2231,988,421HTR2B
PSMD1
common in complete genomics
 On chromosomeChromosome positionIn geneSummary
Rs518147(G;G)X113,818,582HTR2Cnormal
Rs518147(C;C)X113,818,582HTR2Cless weight gain if taking olanzapine
Rs518147(C;G)X113,818,582HTR2Cnormal
Rs6318(C;C)X113,965,735HTR2C1.4x increased risk for cardiac events in patients; apparently stress (cortisol) related
Rs6318(C;G)X113,965,735HTR2CFemale only, since on X ch; appears to mostly be = to common (G;G) genotype
Rs521018X114,583,441HTR2C
Rs498207X114,583,649HTR2C
Rs3813928X114,583,809HTR2C
Rs3813929(C;T)X114,584,047HTR2Cnormal
Rs3813929(T;T)X114,584,047HTR2Cnormal
Rs3813929(C;C)X114,584,047HTR2Cpossible weight gain if taking olanzapine
Rs3813929X114,584,047HTR2C
Rs518147X114,584,109HTR2C
Rs498177X114,590,222HTR2C
Rs6318X114,731,326HTR2C
Rs1414334X114,903,581HTR2C
Rs1414334(C;C)X114,903,581HTR2Cassociated with metabolic syndrome when taking antipsychotics
 On chromosomeChromosome positionIn geneSummary
Rs1150226(C;C)11113,845,541HTR3Acommon in complete genomics
Rs115022611113,974,819HTR3A
Rs106261311113,975,284HTR3A
Rs3394020811113,975,355HTR3A
Rs198524211113,977,551HTR3A
Rs227630211113,979,418HTR3A
Rs1016054811113,985,959HTR3A
Rs117671311113,989,703HTR3A
 On chromosomeChromosome positionIn geneSummary
Rs6277(C;T)11113,283,459DRD21.4x higher schizophrenia risk
Rs6277(T;T)11113,283,459DRD2normal schizophrenia risk, learns NoGo faster
Rs6277(C;C)11113,283,459DRD21.6x higher schizophrenia risk
Rs1800496(C;C)11113,283,488DRD2common in complete genomics
Rs104894220(G;G)11113,287,657DRD2common in clinvar
Rs11214606(C;C)11113,309,869DRD2common on affy axiom data
Rs45460698(AAG;AAG)11113,775,554HTR3B
Rs2276307(A;A)11113,803,887HTR3B
Rs1078997011113,903,224HTR3B
Rs375898711113,904,553HTR3B
Rs4546069811113,904,832HTR3B
Rs1160619411113,910,259HTR3B
Rs117674411113,932,306HTR3B
Rs227630511113,932,382HTR3B
Rs227630711113,933,165HTR3B
Rs378202511113,936,885HTR3B
Rs167271711113,942,011HTR3B
 On chromosomeChromosome positionIn geneSummary
Rs118203884MT4,409HTR3C
Rs6807362(G;G)3183,778,010HTR3Cdecreased autism risk
Rs6807362(C;G)3183,778,010HTR3Cnormal autism risk
Rs6807362(C;C)3183,778,010HTR3Cincreased autism risk
Rs67664103184,056,974HTR3C
Rs68073623184,060,222HTR3C
Rs68076703184,060,510HTR3C
Rs3981246463185,254,016EHHADH
 On chromosomeChromosome positionIn geneSummary
Rs64439303184,036,506HTR3D
 On chromosomeChromosome positionIn geneSummary
Rs56109847(G;G)3183,824,557HTR3Ecommon in complete genomics
Rs76276153184,100,628HTR3E
Rs561098473184,106,769HTR3E
Rs626250443184,106,769HTR3E
 On chromosomeChromosome positionIn geneSummary
Rs171073155147,828,115SPINK1
Rs1048939395147,831,537SPINK1
Rs1939226595147,831,551SPINK1
Rs289357685147,831,576SPINK1
Rs1048939385147,831,576SPINK1
Rs111680485148,462,790HTR4
Rs39950905148,466,252HTR4
Rs77330885148,476,770HTR4
Rs93251045148,543,814HTR4
 On chromosomeChromosome positionIn geneSummary
Rs102397947154,508,809DPP6
Rs18008837155,070,881DOPEY1
HTR5A
Rs63207155,070,911HTR5A
HTR5AOS
 On chromosomeChromosome positionIn geneSummary
Rs1805054119,666,020HTR6
Rs4654903119,874,497
Rs1805054(C;C)119,992,513HTR6common in complete genomics
 On chromosomeChromosome positionIn geneSummary
Rs19353491092,594,343HTR7