Have questions? Visit https://www.reddit.com/r/SNPedia

rs80338725(GCT;GCT)

From SNPedia

common in clinvar
Is agenotype
ofrs80338725
GeneSLC25A13
Chromosome7
Position96,121,928
mentionedby
Magnitude0
ReputeGood
Geno Mag Summary
(-;-) 0 common in clinvar
(-;GAGATTACAGGTGGCTGCCCGGG) 3 Carrier of a citrullinemia/citrin deficiency allele
(GAGATTACAGGTGGCTGCCCGGG;GAGATTACAGGTGGCTGCCCGGG) 5.7 Citrullinemia type II/citrin deficiency; neonatal and/or adult-onset
(GCT;GCT) 0 common in clinvar