Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Geno Mag Summary
(-;-) 0 common in clinvar
(-;GAGATTACAGGTGGCTGCCCGGG) 3 Carrier of a citrullinemia/citrin deficiency allele
(GAGATTACAGGTGGCTGCCCGGG;GAGATTACAGGTGGCTGCCCGGG) 5.7 Citrullinemia type II/citrin deficiency; neonatal and/or adult-onset
(GCT;GCT) 0 common in clinvar
ReferenceGRCh38 38.1/141
is asnp
is mentioned by
1000 genomesrs80338725
23andMe allrs80338725
SNP Nexus

GWAS Ctlgrs80338725
Max Magnitude5.7
Reference Rs80338725(-;-)
Significance Pathogenic
Disease Citrullinemia type II
Variation info
Gene SLC25A13
CLNDBN Citrullinemia type II
Reversed 1
HGVS NC_000007.13:g.95751241_95751263dup23
CLNSRC OMIM Allelic Variant
CLNACC RCV000006371.3,

[PMID 10369257] The gene mutated in adult-onset type II citrullinaemia encodes a putative mitochondrial carrier protein.