Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

common in clinvar
Is agenotype
Geno Mag Summary
(-;-) 6.3 Combined partial 17-alpha-hydroxylase/17,20-lyase deficiency
(-;GCACCAAGACTACAGTGATTGTCGG) 3 Carrier of a partial 17-alpha-hydroxylase/17,20-lyase deficiency mutation