Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205062

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 6.3 Combined partial 17-alpha-hydroxylase/17,20-lyase deficiency
(-;GCACCAAGACTACAGTGATTGTCGG) 3 Carrier of a partial 17-alpha-hydroxylase/17,20-lyase deficiency mutation
(GCACCAAGACTACAGTGATTGTCGG;GCACCAAGACTACAGTGATTGTCGG) 0 common in clinvar
ReferenceGRCh38.p2 38.2/146
Chromosome10
Position102837132
GeneCYP17A1
is asnp
is mentioned by
dbSNPrs786205062
dbSNP (old)rs786205062
ClinGenrs786205062
ebirs786205062
HLIrs786205062
Exacrs786205062
Gnomadrs786205062
Varsomers786205062
Maprs786205062
PheGenIrs786205062
Biobankrs786205062
1000 genomesrs786205062
hgdprs786205062
ensemblrs786205062
gopubmedrs786205062
geneviewrs786205062
scholarrs786205062
googlers786205062
pharmgkbrs786205062
gwascentralrs786205062
openSNPrs786205062
23andMers786205062
23andMe allrs786205062
SNP Nexus

SNPshotrs786205062
SNPdbers786205062
MSV3drs786205062
GWAS Ctlgrs786205062
Max Magnitude6.3
ClinVar
Risk Rs786205062(-;-)
Alt Rs786205062(-;-)
Reference Rs786205062(GCACCAAGACTACAGTGATTGTCGG;GCACCAAGACTACAGTGATTGTCGG)
Significance Pathogenic
Disease Combined partial 17-alpha-hydroxylase/17
Variation info
Gene CYP17A1
CLNDBN Combined partial 17-alpha-hydroxylase/17,20-lyase deficiency
Reversed 1
HGVS NC_000010.10:g.104596889_104596913del25
CLNSRC OMIM Allelic Variant
CLNACC RCV000001868.6,