Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Unaffected carrier of one bad argininosuccinate lyase allele
Is agenotype
Geno Mag Summary
(-;-) 0 common in clinvar
(-;TGGCACTGACCCGAGACTCTGAGCG) 3 Unaffected carrier of one bad argininosuccinate lyase allele

see discussion at Argininosuccinate lyase deficiency