Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Geno Mag Summary
(-;ACATTCTGTTCTTCAAGCACCTATGTCAACCC) 3 carrier of a cystic fibrosis allele

Make rs397508445(-;-)
ReferenceGRCh38 38.1/141
is asnp
is mentioned by
dbSNP (old)rs397508445
1000 genomesrs397508445
23andMe allrs397508445
SNP Nexus

GWAS Ctlgrs397508445
Max Magnitude3
Risk rs397508445(-;-)
Alt rs397508445(-;-)
Significance Pathogenic
Disease Cystic fibrosis
Variation info
CLNDBN Cystic fibrosis
Reversed 0
HGVS NC_000007.13:g.117243787_117243818del32
CLNACC RCV000046704.3,