Have questions? Visit https://www.reddit.com/r/SNPedia

Cystic Fibrosis

From SNPedia
(Redirected from Cystic fibrosis)


The wikipedia article on cystic fibrosis is a good resource to learn about the disease. Cystic fibrosis transmembrane conductance regulator (CFTR) is a gene which influences the condition.

The following OMIM article compiles the latest medical research, and the CFTR2 website maintained by Johns Hopkins University maintains information about all the mutations that have been reported.

  • rs113993960 and i3000001 are also known as Delta F508, and cause of about 70% of cystic fibrosis cases. This mutation is a deletion of three nucleotides. An alternate name for this variant is rs199826652.


The remaining 30% of cases are due to a wide variety of mutations in the same gene, including the following:


The percent of known cystic fibrosis syndrome disease-causing mutations that are tested by several companies is shown in the following table:

SNP % is based on # of magnitude 5+ SNPs on chip vs in SNPedia (unadjusted for mutation frequency)
Gene
Company & chip version CFTR
23andMe v4
0%
23andMe v5 0%
Ancestry v2
75%


For the full curated list and additional information as of July 2018, click to expand the Table below:

CFTR Cystic Fibrosis Pathogenic Mutations
rsid 23andMe term synonyms (c. or p.) OMIM On chip?
rs397508136 c.-9_14del23 (p.Met(?_1)_Pro5(?)) Ancestry v2, Ancestry v2c
rs397508328 c.1A>G (p.Met1Val) Ancestry v2, Ancestry v2c
rs397508173 i5010659 c.11C>A (p.Ser4Ter) Ancestry v2, Ancestry v2c
rs193922501 i5010660 c.14C>T (p.Pro5Leu) Ancestry v2, Ancestry v2c
rs397508742 i5010671 c.50delT (p.Phe17Serfs) Ancestry v2, Ancestry v2c
rs397508746 i5010675 c.53+1G>T Ancestry v2
rs397508796 c.79G>T (p.Gly27Ter)
rs397508815 i5010686 c.88C>T (p.Gln30X) Ancestry v2
rs397508168 i5010697 c.115C>T (p.Gln39Ter) Ancestry v2, Ancestry v2c
rs151020603 c.137C>A (p.Ala46Asp) Ancestry v2, Ancestry v2c
rs397508243 c.164+1G>A Ancestry v2c
rs397508243 c.164+1G>T Ancestry v2c
rs121908800 c.164+2T>C Ancestry v2
rs397508244 i5012197 c.164+3_164+4insT Ancestry v2
rs200337193 c.165-3C>T Ancestry v2
rs397508249 i5010717 c.165-1G>A Ancestry v2, Ancestry v2c
rs397508256 i5010728 c.166G>A (p.Glu56Lys) Ancestry v2, Ancestry v2c
rs397508272 c.169T>G (p.Trp57Gly)
rs397508279 i5006093 c.170G>A (p.Trp57Ter) Ancestry v2, Ancestry v2c
rs121909025 i5006094 c.171G>A (p.Trp57Ter) Ancestry v2, Ancestry v2c
rs397508294 i5010736 c.174_175insA Ancestry v2, Ancestry v2c
rs77284892 i5010738 c.178G>T (p.Glu60Ter) Ancestry v2
rs368505753 i5010743 c.200C>T (p.Pro67Leu) Ancestry v2, Ancestry v2c
rs121908749 i5010753 c.223C>T (p.Arg75Ter) Ancestry v2, Ancestry v2c
rs397508366 c.233dupT (p.Trp79Leufs)
rs75961395 i4000294 c.254G>A (p.Gly85Glu) 602421.0038 Ancestry v2
rs121908769 i4000313 c.262_263delTT (p.Leu88Ilefs) 602421.0128
rs397508412 c.263T>A (p.Leu88X)
rs397508412 c.263T>G (p.Leu88X)
rs121908791 i5010781 c.273+1G>A Ancestry v2, Ancestry v2c
rs74467662 i5010780 c.273+3A>C Ancestry v2, Ancestry v2c
rs397508426 c.274-2A>G Ancestry v2
rs121908792 i5010784 c.274-1G>A Ancestry v2, Ancestry v2c
rs121908751 c.274G>A (p.Glu92Lys) 602421.0077
rs121908751 c.274G>T (p.Glu92Ter) 602421.0082
rs397508461 i5010801 c.292C>T (p.Gln98Ter) Ancestry v2, Ancestry v2c
rs397508464 c.293A>G (p.Gln98Arg)
rs397508467 i5010804 c.296C>T (p.Pro99Leu) Ancestry v2
rs397508499 i5010811 c.310delA (p.Arg104Glufs) Ancestry v2, Ancestry v2c
rs121908801 i5010812 c.313delA (p.Ile105Serfs) Ancestry v2, Ancestry v2c
rs121908798 c.325_327delTATinsG (p.Tyr109Glyfs)
rs113993958 i5006048 c.328G>C (p.Asp110His) 602421.0004
rs397508537 i5010827 c.330C>A (p.Asp110Glu) Ancestry v2
rs77834169 rs77834169 c.349C>T (p.Arg117Cys) Ancestry v2, 23andMe v5
rs79660178 rs79660178 c.366T>A (p.Tyr122Ter) Ancestry v2, 23andMe v5, Ancestry v2c
rs397508672 i5010858 c.409delC (p.Leu137Serfs) Ancestry v2
rs121908770 c.442delA (p.Ile148Leufs) Ancestry v2, Ancestry v2c
rs397508733 i4000314 c.489+1G>T
rs397508736 i5010919 c.494T>C (p.Leu165Ser) Ancestry v2
rs121908771 i5010929 c.531delT (p.Ile177Metfs) Ancestry v2
rs80282562 i5010930 c.532G>A (p.Gly178Arg) Ancestry v2, Ancestry v2c
rs397508750 c.543_546delTAGT (p.Leu183Phefs) Ancestry v2, Ancestry v2c
rs397508759 c.577G>T (p.Glu193Ter)
rs77188391 i4000315 c.579+1G>T Ancestry v2, Ancestry v2c
rs397508761 c.579+3A>G
rs78440224 i5010947 c.579+5G>A Ancestry v2, Ancestry v2c
rs376008630 i5010953 c.580-1G>T
rs121908802 i5010957 c.595C>T (p.His199Tyr) Ancestry v2, Ancestry v2c
rs121908803 i5010966 c.613C>T (p.Pro205Ser) Ancestry v2, Ancestry v2c
rs121908752 i5006101 c.617T>G (p.Leu206Trp) 602421.0084 Ancestry v2, Ancestry v2c
rs397508775 i5010975 c.647G>A (p.Trp216X) Ancestry v2
rs397508778 i5010980 c.658C>T (p.Gln220Ter) Ancestry v2, Ancestry v2c
rs397508782 i5010985 c.680T>G (p.Leu227Arg) Ancestry v2, Ancestry v2c
rs121908804 c.720_741delAGGGAGAATGATGATGAAGTAC (p.Gly241Glufs) 602421.0041 Ancestry v2c
rs148519623 i5011007 c.794T>G (p.Met265Arg) Ancestry v2
rs121908772 i5011008 c.803delA (p.Asn268Ilefs) Ancestry v2, Ancestry v2c
rs193922532 i6008902 c.825C>G (p.Tyr275X) Ancestry v2, Ancestry v2c
rs397508799 i5011011 c.828C>A (p.Cys276Ter) Ancestry v2, Ancestry v2c
rs397508805 c.859_863delAACTT
rs121909016 i5011050 c.933C>G (p.Phe311Leu) Ancestry v2, Ancestry v2c
rs121908744 c.948delT (p.Phe316Leufs) 602421.0059 Ancestry v2, Ancestry v2c
rs397508824 i5011072 c.987delA (p.Gly330Glufs) Ancestry v2, Ancestry v2c
rs79031340 i5011073, i5053826 c.988G>T (p.Gly330Ter) Ancestry v2, Ancestry v2c
rs121909011 i4000296, rs121909011 c.1000C>T (p.Arg334Trp) 602421.0034 Ancestry v2, Ancestry v2c
rs397508137 c.1001G>T (p.Arg334Leu)
rs397508138 i50411080 c.1006_1007insG (p.Ile336Serfs) Ancestry v2, Ancestry v2c
rs397508139 c.1007T>A (p.Ile336Lys) Ancestry v2, Ancestry v2c
rs77409459 i5053827, rs77409459 c.1013C>T (p.Thr338Ile) 602421.0087 Ancestry v2, 23andMe v5, Ancestry v2c
rs397508144 c.1021T>C (p.Ser341Pro)
rs387906360 c.1022_1023insTC Ancestry v2, Ancestry v2c
rs121908774 c.1029delC (p.Cys343Terfs)
rs77932196 i4000297 c.1040G>C (p.Arg347Pro) 602421.0006
rs77932196 c.1040G>A (p.Arg347His) 602421.0078
rs121908753 i5006107 c.1055G>A (p.Arg352Gln) 602421.0092 Ancestry v2, Ancestry v2c
rs387906361 c.1081delT (p.Trp361Glyfs) 602421.0031 Ancestry v2, Ancestry v2c
rs397508158 c.1116+1G>A Ancestry v2c
rs556880586 i5011131 c.1117-1G>A Ancestry v2, Ancestry v2c
rs397508163 i5011139 c.1127_1128insA Ancestry v2, Ancestry v2c
rs121908785 i5011146 c.1153_1154insAT (p.Asn386Ilefs)
rs397508174 i5011161 c.1202G>A (p.Trp401Ter) Ancestry v2, Ancestry v2c
rs397508175 c.1201G>C (p.Trp401Ter) Ancestry v2, Ancestry v2c
rs397508177 i5011170 c.1209+1G>A
rs397508183 i5011184 c.1240C>T (p.Gln414Ter) Ancestry v2, Ancestry v2c
rs397508189 c.1329_1330insAGAT
rs397508192 c.1340delA (p.Lys447Argfs) Ancestry v2c
rs74551128 i4000291, i5006050 c.1364C>A (p.Ala455Glu) 602421.0007
rs797045161 c.1365_1366delGG (p.Val456Cysfs)
rs193922500 i5011208 c.1367T>C (p.Val456Ala) Ancestry v2, Ancestry v2c
rs397508196 c.1373delG (p.Gly458AspfsX11) Ancestry v2, Ancestry v2c
rs397508201 i5011217 c.1393-2A>G Ancestry v2
rs397508200 i5006135, i5011216 c.1393-1G>A Ancestry v2, Ancestry v2c
rs121908805 c.1397C>A (p.Ser466Ter) Ancestry v2c
rs121908805 c.1397C>G (p.Ser466Ter) Ancestry v2c
rs139573311 c.1400T>C (p.Leu467Pro) Ancestry v2, Ancestry v2c
rs397508205 c.1418delG (p.Gly473Glufs) Ancestry v2, Ancestry v2c
rs397508211 i5011243 c.1466C>A (p.Ser489Ter) Ancestry v2, Ancestry v2c
rs121909017 i5006080 c.1475C>T (p.Ser492Phe) 602421.0051 Ancestry v2, Ancestry v2c
rs77101217 i5006047 c.1477C>T (p.Gln493Ter) 602421.0003 Ancestry v2, Ancestry v2c
rs121908775 c.1477_1478delCA (p.Gln493Valfs) 602421.0115
rs397508216 i5011252 c.1487G>A (p.Trp496X) Ancestry v2
rs121908745 i4000292 c.1519_1521delATC (p.Ile507del) 602421.0002 Ancestry v2
rs113993960 i3000001 c.1521_1523delCTT (p.Phe508del) 602421.0001 Ancestry v2, Ancestry v2c
rs397508225 i5011273 c.1538A>G (p.Asp513Gly) Ancestry v2
rs121908776 c.1545_1546delTA (p.Tyr515Terfs) 602421.0035 Ancestry v2
rs77646904 i4000299 c.1558G>T (p.Val520Phe) 602421.0046
rs121908754 i5006076 c.1572C>A (p.Cys524Ter) 602421.0047 Ancestry v2, Ancestry v2c
rs397508227 i5011284 c.1573C>T (p.Gln525Ter) Ancestry v2, Ancestry v2c
rs397508230 c.1584+1G>A
rs193922503 i5011304 c.1585-8G>A Ancestry v2, Ancestry v2c
rs76713772 i4000317, rs76713772 c.1585-1G>A Ancestry v2, Ancestry v2c
rs113993959 i4000300, rs113993959 c.1624G>T (p.Gly542Ter) 602421.0009, 602421.0095 Ancestry v2, Ancestry v2c
rs121908757 i5006053 c.1645A>C (p.Ser549Arg) Ancestry v2, Ancestry v2c
rs121908755 i4000301, i5011323 c.1646G>A (p.Ser549Asn) 602421.001 Ancestry v2c
rs121909005 c.1647T>G (p.Ser549Arg) Ancestry v2, 23andMe v5, Ancestry v2c
rs397508247 c.1648G>T (p.Gly550Ter)
rs397508251 i5011328 c.1650delA (p.Gly551Valfs) Ancestry v2, Ancestry v2c
rs121909013 i5006072 c.1651G>A (p.Gly551Ser) Ancestry v2, Ancestry v2c
rs75527207 i4000305, rs75527207 c.1652G>A (p.Gly551Asp) 602421.0013 Ancestry v2, Ancestry v2c
rs76554633 i5006110 c.1654C>T (p.Gln552Ter) 602421.0096 Ancestry v2, Ancestry v2c
rs74597325 i4000306 c.1657C>T (p.Arg553Ter) 602421.0014 Ancestry v2
rs397508257 i5011341 c.1670delC (p.Ser557PhefsX2) Ancestry v2
rs75549581 i5006056 c.1675G>A (p.Ala559Thr) 602421.0015 Ancestry v2, Ancestry v2c
rs80055610 i4000307, i5011359 c.1679G>C (p.Arg560Thr) 602421.0016
rs80055610 c.1679G>A (p.Arg560Lys) 602421.0052
rs397508263 c.1679+1G>C Ancestry v2, Ancestry v2c
rs397508263 i5006138 c.1679+1G>A Ancestry v2, Ancestry v2c
rs397508267 i5011360 c.1680A>C (p.Arg560Ser) Ancestry v2
rs121909047 i5006134 c.1682C>A (p.Ala561Glu) Ancestry v2, Ancestry v2c
rs121909006 c.1687T>A (p.Tyr563Asn) Ancestry v2c
rs121909006 c.1687T>G (p.Tyr563Asp) Ancestry v2c
rs193922505 c.1692delA (p.Asp565Metfs) Ancestry v2
rs397508274 i5011377 c.1703delT (p.Leu568CysfsX4) Ancestry v2
rs397508276 c.1705T>G (p.Tyr569Asp)
rs121908758 i5006058 c.1721C>A (p.Pro574His) Ancestry v2, Ancestry v2c
rs773569201 i6008923 c.1724T>A (p.Phe575Tyr)
rs397508296 i5011404 c.1753G>T (p.Glu585Ter) Ancestry v2, Ancestry v2c
rs121908748 i4000318, i5011417 c.1766+1G>A
rs121908748 c.1766+1G>C
rs121908748 c.1766+1G>T
rs397508298 c.1766+3A>G Ancestry v2c
rs121908796 c.1766+5G>T Ancestry v2
rs397508303 c.1792_1798delAAAACTA (p.Lys598Glyfs) Ancestry v2, Ancestry v2c
rs397508310 c.1826A>G (p.His609Arg)
rs121908759 i5011446 c.1865G>A (p.Gly622Asp) Ancestry v2, Ancestry v2c
rs397508326 i5011470 c.1986_1989delAACT (p.Thr663ArgfsX8)
rs121908812 c.2012delT (p.Leu671Terfs)
rs397508331 i5011477 c.2017G>T (p.Gly673Ter) Ancestry v2, Ancestry v2c
rs121908799 i4000319 c.2051_2052delAAinsG
rs121908786 c.2052_2053insA Ancestry v2
rs121908746 c.2052delA (p.Lys684Asnfs) Ancestry v2
rs797045162 c.2053_2054insC Ancestry v2c
rs397508336 c.2053C>T (p.Gln685Ter) Ancestry v2, Ancestry v2c
rs121908760 rs121908760 c.2125C>T (p.Arg709Ter) Ancestry v2, 23andMe v5, Ancestry v2c
rs75115087 i5006112, i5053833 c.2128A>T (p.Lys710Ter) 602421.0098 Ancestry v2, Ancestry v2c
rs397508343 i5011504 c.2143C>T (p.Gln715X) Ancestry v2
rs397508346 i5011506 c.2158C>T (p.Gln720X) Ancestry v2
rs121908787 i5011509,i5053858 c.2175_2176insA Ancestry v2, Ancestry v2c
rs397508350 i5011511 c.2195T>G (p.Leu732Ter) Ancestry v2
rs397508353 i5011516 c.2215delG (p.Val739Tyrfs) Ancestry v2, Ancestry v2c
rs121908810 rs121908810 c.2290C>T (p.Arg764Ter) Ancestry v2, 23andMe v5, Ancestry v2c
rs374946172 i5011540 c.2353C>T (p.Arg785Ter) Ancestry v2, Ancestry v2c
rs145449046 i5011543 c.2374C>T (p.Arg792Ter) Ancestry v2
rs387906359 i5011551 c.2421_2422dupAT (p.Ser809Ilefs) Ancestry v2, Ancestry v2c
rs797045157 i5011551 c.2423_2424dupAT
rs397515498 i5011556 c.2453delT (p.Leu818Trpfs) Ancestry v2, Ancestry v2c
rs797045156 c.2462_2463delGT (p.Ser821Argfs)
rs397508378 c.2464G>T (p.Glu822Ter)
rs141158996 i6056295 c.2490+1G>A 602421.0071 Ancestry v2, Ancestry v2c
rs397508387 i5011571 c.2491G>T (p.Glu831Ter) Ancestry v2, Ancestry v2c
rs397508393 i5006063 c.2537G>A (p.Trp846Ter) Ancestry v2, Ancestry v2c
rs397508394 i5011583 c.2547C>A (p.Tyr849Ter) Ancestry v2, Ancestry v2c
rs121909012 i5006071 c.2551C>T (p.Arg851Ter) 602421.0036 Ancestry v2, Ancestry v2c
rs397508399 c.2583delT (p.Phe861Leufs) Ancestry v2, Ancestry v2c
rs397508400 c.2589_2599delAATTTGGTGCT (p.Ile864Serfs) Ancestry v2, Ancestry v2c
rs397508405 c.2600_2601insA Ancestry v2, Ancestry v2c
rs397508413 c.2645G>A (p.Trp882X)
rs80224560 i4000320, rs80224560 c.2657+5G>A Ancestry v2, Ancestry v2c
rs397508416 c.2658-1G>C Ancestry v2
rs79633941 i5053834 c.2668C>T (p.Gln890Ter) 602421.0099 Ancestry v2, 23andMe v5, Ancestry v2c
rs121909034 c.2735C>A (p.Ser912Ter) Ancestry v2
rs121908788 i5012228 c.2737_2738insG (p.Tyr913Ter) Ancestry v2, Ancestry v2c
rs149790377 i5011647 c.2739T>A (p.Tyr913Ter) Ancestry v2, Ancestry v2c
rs397508431 c.2764_2765insAG (p.Val922Glufs) Ancestry v2, Ancestry v2c
rs397508435 i5011662 c.2780T>C (p.Leu927Pro) Ancestry v2, Ancestry v2c
rs193922510 i5011667 c.2810_2811insT Ancestry v2, Ancestry v2c
rs397508441 c.2825delT (p.Ile942Thrfs) Ancestry v2, 23andMe v5, Ancestry v2c
rs397508442 i5011672 c.2834C>T (p.Ser945Leu) Ancestry v2, Ancestry v2c
rs397508445 c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC (p.Leu953Phefs)
rs397508447 i5011682 c.2875delG (p.Ala959Hisfs) Ancestry v2c
rs397508451 i5011685 c.2896delA (p.Thr966Argfs) Ancestry v2, Ancestry v2c
rs397508453 i5011692 c.2908G>C (p.Gly970Arg) Ancestry v2c
rs397508462 i5011709 c.2936A>T (p.Asp979Val)
rs121908797 rs121908797 c.2988G>A (p.Gln996=) Ancestry v2, 23andMe v5, Ancestry v2c
rs75096551 i4000321, rs75096551 c.2988+1G>A Ancestry v2, Ancestry v2c
rs193922515 c.2989-2A>G Ancestry v2, Ancestry v2c
rs397508470 c.2989-1G>A Ancestry v2, Ancestry v2c
rs397508477 i5011741 c.3002_3003delTG (p.Val1001Aspfs) Ancestry v2, Ancestry v2c
rs121908781 c.3039delC (p.Tyr1014Thrfs) Ancestry v2, Ancestry v2c
rs397508485 c.3039_3040insC (p.Tyr1014LeufsX33)
rs144055758 c.3095A>G (p.Tyr1032Cys) Ancestry v2, Ancestry v2c
rs397508500 i5011775 c.3124C>T (p.Gln1042X) Ancestry v2
rs397508505 c.3139_3139+1delGG (p.Gly1047GlnfsX28) Ancestry v2, Ancestry v2c
rs397508508 i5011792, i5053854 c.3140-26A>G Ancestry v2
rs397508510 i5011800 c.3160C>G (p.His1054Asp) Ancestry v2
rs142394380 i5011808 c.3181G>C (p.Gly1061Arg) Ancestry v2, Ancestry v2c
rs121909036 i5006115 c.3194T>C (p.Leu1065Pro) 602421.0103 Ancestry v2, Ancestry v2c
rs78194216 i5053836, rs78194216 c.3196C>T (p.Arg1066Cys) 602421.0058 Ancestry v2, 23andMe v5
rs121909019 i5006083 c.3197G>A (p.Arg1066His) 602421.0054 Ancestry v2, Ancestry v2c
rs139304906 i5011836 c.3230T>C (p.Leu1077Pro) Ancestry v2, Ancestry v2c
rs78802634 i5006103, i5053839 c.3266G>A (p.Trp1089Ter) 602421.0088 Ancestry v2, Ancestry v2c
rs121908761 c.3276C>A (p.Tyr1092Ter) Ancestry v2c
rs121908761 c.3276C>G (p.Tyr1092Ter) Ancestry v2c
rs397508532 c.3293G>A (p.Trp1098Ter) Ancestry v2, Ancestry v2c
rs397508533 i5011862 c.3294G>A (p.Trp1098Ter) Ancestry v2
rs36210737 rs36210737 c.3302T>A (p.Met1101Lys) 602421.0137 23andMe v3, 23andMe v4, 23andMe v5
rs397508536 c.3304A>T (p.Arg1102Ter) Ancestry v2, Ancestry v2c
rs397508538 i5011868 c.3310G>T (p.Glu1104Ter) Ancestry v2, Ancestry v2c
rs146521846 c.3353C>T (p.Ser1118Phe) Ancestry v2
rs755416052 i5011886 c.3368-2A>G
rs397508561 i5011908 c.3435G>A (p.Thr1145X) Ancestry v2
rs397508567 i5011914 c.3458T>A (p.Val1153Glu) Ancestry v2
rs139729994 c.3468G>A Ancestry v2, Ancestry v2c
rs79850223 i5006074 c.3472C>T (p.Arg1158Ter) 602421.0039
rs397508573 c.3476C>T (p.Ser1159Phe) Ancestry v2
rs74767530 i4000308, i6056298 c.3484C>T (p.Arg1162Ter) 602421.0033 Ancestry v2, Ancestry v2c
rs121908747 i4000322 c.3528delC (p.Lys1177Serfs) Ancestry v2, Ancestry v2c
rs387906378 i5011943 c.3535_3536insTCAA (p.Thr1179Ilefs) Ancestry v2, Ancestry v2c
rs121908763 i5011952 c.3587C>G (p.Ser1196Ter) Ancestry v2, Ancestry v2c
rs397508587 i5011956 c.3605delA (p.Asp1202Alafs) Ancestry v2, Ancestry v2c
rs121908764 i5006120 c.3611G>A (p.Trp1204Ter) Ancestry v2
rs121908765 i5006119 c.3612G>A (p.Trp1204Ter) Ancestry v2, Ancestry v2c
rs121908811 c.3659delC (p.Thr1220Lysfs) 602421.002 Ancestry v2
rs121908783 i5012241 c.3691delT (p.Ser1231Profs) Ancestry v2, Ancestry v2c
rs75389940 i5053843 c.3700A>G (p.Ile1234Val) 602421.011
rs387906362 i5011985 c.3717+4A>G Ancestry v2, Ancestry v2c
rs193922520 i5011984 c.3717+5G>A Ancestry v2, Ancestry v2c
rs75039782 i4000325, rs75039782 c.3717+12191C>T Ancestry v2
rs397508596 i5011990 c.3718-3T>G Ancestry v2, Ancestry v2c
rs387906369 i5011989 c.3718-1G>A 602421.0073 Ancestry v2, Ancestry v2c
rs267606723 c.3731G>A (p.Gly1244Glu) Ancestry v2
rs397508600 i5012000 c.3737C>T (p.Thr1246Ile) Ancestry v2
rs121908784 i4000323, i5012003 c.3744delA (p.Lys1250Argfs) 602421.0127
rs797045159 c.3747delG (p.Lys1250Argfs) Ancestry v2c
rs74503330 i5006123, i5053845 c.3752G>A (p.Ser1251Asn) 602421.0112 Ancestry v2
rs397508604 i5012010 c.3761T>G (p.Leu1254Ter) Ancestry v2, Ancestry v2c
rs121909041 i5006124 c.3763T>C (p.Ser1255Pro) Ancestry v2, Ancestry v2c
rs76649725 rs76649725 c.3764C>A (p.Ser1255Ter) 23andMe v5
rs121908789 i4000324, i5012017 c.3773_3774insT
rs77010898 i4000309 c.3846G>A (p.Trp1282Ter) 602421.0022 Ancestry v2, Ancestry v2c
rs77902683 i5006086 c.3848G>T (p.Arg1283Met)
rs121909015 c.3873+1G>A Ancestry v2, Ancestry v2c
rs146795445 i5012054 c.3873+2T>C Ancestry v2
rs397508628 c.3882_3885delTATT
rs397508630 c.3883delA (p.Ile1295Phefs)
rs121908808 c.3884_3885insT
rs397508631 i5012071 c.3889dupT (p.Ser1297PhefsX5)
rs397508631 i5012071 c.3890_3891insT (p.Gly1298TrpfsX4)
rs797045158 c.3899dupT (p.Arg1301Terfs)
rs397508637 c.3908delA (p.Asn1303Thrfs) Ancestry v2c
rs80034486 i4000311, rs80034486 c.3909C>G (p.Asn1303Lys) 602421.0032 Ancestry v2c
rs121909026 i5006095 c.3937C>T (p.Gln1313Ter) 602421.0076
rs397508658 i5012112 c.4004T>C (p.Leu1335Pro) Ancestry v2
rs397508662 c.4036_4042delCTAAGCC (p.Leu1346MetfsX6) Ancestry v2
rs193922525 i5012121 c.4046G>A (p.Gly1349Asp) Ancestry v2, Ancestry v2c
rs397508668 i5012253 c.4077_4080delTGTTinsAA (p.Val1360Thrfs)
rs397508669 i5012254 c.4086_4087insT Ancestry v2, Ancestry v2c
rs397508675 i5012129 c.4111G>T (p.Glu1371Ter) Ancestry v2, Ancestry v2c
rs397508684 i5012142 c.4144C>T (p.Gln1382Ter) Ancestry v2, Ancestry v2c
rs397508685 i5012143 c.4147_4148insA Ancestry v2, Ancestry v2c
rs397508693 c.4196_4197delTC Ancestry v2, Ancestry v2c
rs397508701 i5012162 c.4231C>T (p.Gln1411Ter) Ancestry v2, Ancestry v2c
rs397508702 i5012163 c.4234C>T (p.Gln1412Ter) Ancestry v2, Ancestry v2c
rs372227120 c.4242+1G>T Ancestry v2
rs372227120 c.4242+1G>A Ancestry v2
rs397508706 c.4251delA (p.Glu1418Argfs) Ancestry v2c
rs397508709 c.4296_4297insGA (p.Ser1435Glyfs) Ancestry v2


SNPs in other genes may also influence the course and severity of cystic fibrosis. However, several reports of such SNPs have not been able to be replicated [PMID 21614089]. Perhaps the largest study to date (2011; [PMID 21602797] is based on ~3,000 patients, most of whom were homozygous for the delta508 mutation, and from it, the following SNPs were found to be either "significant" or "suggestive", with the risk allele (worse lung function) shown indexed to the forward strand as shown in NCBI build 36:


Additional Publications/Findings:

[2] a small percentage of CF sufferers with a rare genetic stop mutation (Y122X) responded positively to Gentamicin treatment.

[3] Study reveals how cells destroy faulty proteins in cystic fibrosis.

Heterozygous CFTR mutation carriers are at slightly higher (1.6x) risk for asthma, according to a 2016 meta-analysis.[PMID 27324553]

With CF the body will make or absorb too much oxalate. Here is a Yahoo! group of people who are interested in trying low oxalate diets.

Yahoo CF directory

CF Parents

Ambry Genetics offers genetic testing for cystic fibrosis. You can see some of the Ambry related discussion in the cysticfibrosis.com forums.

[4] HIV can be used to correct faulty cystic fibrosis gene in mice.


Normals Nature Genetics 25aug13 Del

ins