Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs876661303

From SNPedia

ClinVar
Risk rs876661303(CGAGCTCCAGGCCCAGATCGC;CGAGCTCCAGGCCCAGATCGC)
Alt rs876661303(CGAGCTCCAGGCCCAGATCGC;CGAGCTCCAGGCCCAGATCGC)
Reference Rs876661303(-;-)
Significance Pathogenic
Disease May-Hegglin anomaly
Variation info
Gene MYH9
CLNDBN May-Hegglin anomaly
Reversed 1
HGVS NC_000022.10:g.36692946_36692966dup21
CLNSRC OMIM Allelic Variant
CLNACC RCV000015141.21,