Have questions? Visit https://www.reddit.com/r/SNPedia

rs876661303

From SNPedia
Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs876661303(-;CGAGCTCCAGGCCCAGATCGC)
Make rs876661303(CGAGCTCCAGGCCCAGATCGC;CGAGCTCCAGGCCCAGATCGC)
ReferenceGRCh38.p2 38.2/147
Chromosome22
Position36296899
GeneMYH9
is asnp
is mentioned by
dbSNPrs876661303
dbSNP (old)rs876661303
ClinGenrs876661303
ebirs876661303
HLIrs876661303
Exacrs876661303
Gnomadrs876661303
Varsomers876661303
Maprs876661303
PheGenIrs876661303
Biobankrs876661303
1000 genomesrs876661303
hgdprs876661303
ensemblrs876661303
gopubmedrs876661303
geneviewrs876661303
scholarrs876661303
googlers876661303
pharmgkbrs876661303
gwascentralrs876661303
openSNPrs876661303
23andMers876661303
23andMe allrs876661303
SNP Nexus

SNPshotrs876661303
SNPdbers876661303
MSV3drs876661303
GWAS Ctlgrs876661303
Max Magnitude0
ClinVar
Risk rs876661303(CGAGCTCCAGGCCCAGATCGC;CGAGCTCCAGGCCCAGATCGC)
Alt rs876661303(CGAGCTCCAGGCCCAGATCGC;CGAGCTCCAGGCCCAGATCGC)
Reference Rs876661303(-;-)
Significance Pathogenic
Disease May-Hegglin anomaly
Variation info
Gene MYH9
CLNDBN May-Hegglin anomaly
Reversed 1
HGVS NC_000022.10:g.36692946_36692966dup21
CLNSRC OMIM Allelic Variant
CLNACC RCV000015141.21,