Have questions? Visit https://www.reddit.com/r/SNPedia

rs876661302

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(CGAGCTCCAGGCCCAGATCGC;CGAGCTCCAGGCCCAGATCGC) 0 common in clinvar
Make rs876661302(-;-)
Make rs876661302(-;CGAGCTCCAGGCCCAGATCGC)
ReferenceGRCh38.p2 38.2/147
Chromosome22
Position36296900
GeneMYH9
is asnp
is mentioned by
dbSNPrs876661302
dbSNP (old)rs876661302
ClinGenrs876661302
ebirs876661302
HLIrs876661302
Exacrs876661302
Gnomadrs876661302
Varsomers876661302
Maprs876661302
PheGenIrs876661302
Biobankrs876661302
1000 genomesrs876661302
hgdprs876661302
ensemblrs876661302
gopubmedrs876661302
geneviewrs876661302
scholarrs876661302
googlers876661302
pharmgkbrs876661302
gwascentralrs876661302
openSNPrs876661302
23andMers876661302
23andMe allrs876661302
SNP Nexus

SNPshotrs876661302
SNPdbers876661302
MSV3drs876661302
GWAS Ctlgrs876661302
Max Magnitude0
ClinVar
Risk rs876661302(-;-)
Alt rs876661302(-;-)
Reference Rs876661302(CGAGCTCCAGGCCCAGATCGC;CGAGCTCCAGGCCCAGATCGC)
Significance Pathogenic
Disease May-Hegglin anomaly Sebastian syndrome
Variation info
Gene MYH9
CLNDBN May-Hegglin anomaly Sebastian syndrome
Reversed 1
HGVS NC_000022.10:g.36692946_36692966del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000015139.25, RCV000015140.25,