Have questions? Visit https://www.reddit.com/r/SNPedia

rs876659293

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(TACTTGCCAAGGCAAGATCT;TACTTGCCAAGGCAAGATCT) 0 common in clinvar
Make rs876659293(-;-)
Make rs876659293(-;TACTTGCCAAGGCAAGATCT)
ReferenceGRCh38.p2 38.2/147
Chromosome17
Position43074333
GeneBRCA1
is asnp
is mentioned by
dbSNPrs876659293
dbSNP (old)rs876659293
ClinGenrs876659293
ebirs876659293
HLIrs876659293
Exacrs876659293
Gnomadrs876659293
Varsomers876659293
Maprs876659293
PheGenIrs876659293
Biobankrs876659293
1000 genomesrs876659293
hgdprs876659293
ensemblrs876659293
gopubmedrs876659293
geneviewrs876659293
scholarrs876659293
googlers876659293
pharmgkbrs876659293
gwascentralrs876659293
openSNPrs876659293
23andMers876659293
23andMe allrs876659293
SNP Nexus

SNPshotrs876659293
SNPdbers876659293
MSV3drs876659293
GWAS Ctlgrs876659293
Max Magnitude0
ClinVar
Risk rs876659293(-;-)
Alt rs876659293(-;-)
Reference Rs876659293(TACTTGCCAAGGCAAGATCT;TACTTGCCAAGGCAAGATCT)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome
Variation info
Gene BRCA1
CLNDBN Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000017.10:g.41226350_41226369del20
CLNSRC
CLNACC RCV000217564.1,