Have questions? Visit https://www.reddit.com/r/SNPedia

rs864321619

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs864321619(-;CGTTGATTTCAGAGAATATGA)
Make rs864321619(CGTTGATTTCAGAGAATATGA;CGTTGATTTCAGAGAATATGA)
ReferenceGRCh38.p2 38.2/146
Chromosome13
Position28034125
GeneFLT3
is asnp
is mentioned by
dbSNPrs864321619
dbSNP (old)rs864321619
ClinGenrs864321619
ebirs864321619
HLIrs864321619
Exacrs864321619
Gnomadrs864321619
Varsomers864321619
Maprs864321619
PheGenIrs864321619
Biobankrs864321619
1000 genomesrs864321619
hgdprs864321619
ensemblrs864321619
gopubmedrs864321619
geneviewrs864321619
scholarrs864321619
googlers864321619
pharmgkbrs864321619
gwascentralrs864321619
openSNPrs864321619
23andMers864321619
23andMe allrs864321619
SNP Nexus

SNPshotrs864321619
SNPdbers864321619
MSV3drs864321619
GWAS Ctlgrs864321619
Max Magnitude0
ClinVar
Risk rs864321619(CGTTGATTTCAGAGAATATGA;CGTTGATTTCAGAGAATATGA)
Alt rs864321619(CGTTGATTTCAGAGAATATGA;CGTTGATTTCAGAGAATATGA)
Reference Rs864321619(-;-)
Significance Pathogenic
Disease Myelodysplastic syndrome progressed to acute myeloid leukemia
Variation info
Gene FLT3
CLNDBN Myelodysplastic syndrome progressed to acute myeloid leukemia
Reversed 1
HGVS NC_000013.10:g.28608263_28608283dup21
CLNSRC
CLNACC RCV000203482.1,