Have questions? Visit https://www.reddit.com/r/SNPedia

rs864321619

From SNPedia

ClinVar
Risk rs864321619(CGTTGATTTCAGAGAATATGA;CGTTGATTTCAGAGAATATGA)
Alt rs864321619(CGTTGATTTCAGAGAATATGA;CGTTGATTTCAGAGAATATGA)
Reference Rs864321619(-;-)
Significance Pathogenic
Disease Myelodysplastic syndrome progressed to acute myeloid leukemia
Variation info
Gene FLT3
CLNDBN Myelodysplastic syndrome progressed to acute myeloid leukemia
Reversed 1
HGVS NC_000013.10:g.28608263_28608283dup21
CLNSRC
CLNACC RCV000203482.1,