Have questions? Visit https://www.reddit.com/r/SNPedia

rs863224229

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(GGCCGGGTGCGATGGCGGCGGTGG;GGCCGGGTGCGATGGCGGCGGTGG) 0 common in clinvar
Make rs863224229(-;-)
Make rs863224229(-;GGCCGGGTGCGATGGCGGCGGTGG)
ReferenceGRCh38.p2 38.2/146
Chromosome9
Position133356441
GeneSURF1, SURF2
is asnp
is mentioned by
dbSNPrs863224229
dbSNP (old)rs863224229
ClinGenrs863224229
ebirs863224229
HLIrs863224229
Exacrs863224229
Gnomadrs863224229
Varsomers863224229
Maprs863224229
PheGenIrs863224229
Biobankrs863224229
1000 genomesrs863224229
hgdprs863224229
ensemblrs863224229
gopubmedrs863224229
geneviewrs863224229
scholarrs863224229
googlers863224229
pharmgkbrs863224229
gwascentralrs863224229
openSNPrs863224229
23andMers863224229
23andMe allrs863224229
SNP Nexus

SNPshotrs863224229
SNPdbers863224229
MSV3drs863224229
GWAS Ctlgrs863224229
Max Magnitude0
ClinVar
Risk rs863224229(-;-)
Alt rs863224229(-;-)
Reference Rs863224229(GGCCGGGTGCGATGGCGGCGGTGG;GGCCGGGTGCGATGGCGGCGGTGG)
Significance Pathogenic
Disease not provided Leigh syndrome
Variation info
Gene SURF2 SURF1
CLNDBN not provided Leigh syndrome
Reversed 1
HGVS NC_000009.11:g.136223317_136223340del24
CLNSRC
CLNACC RCV000199102.1, RCV000258857.1,