Have questions? Visit https://www.reddit.com/r/SNPedia

rs794728425

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs794728425(-;CGGCCAGCTCCCATCGCCCC)
Make rs794728425(CGGCCAGCTCCCATCGCCCC;CGGCCAGCTCCCATCGCCCC)
ReferenceGRCh38.p2 38.2/146
Chromosome7
Position150958220
GeneKCNH2
is asnp
is mentioned by
dbSNPrs794728425
dbSNP (old)rs794728425
ClinGenrs794728425
ebirs794728425
HLIrs794728425
Exacrs794728425
Gnomadrs794728425
Varsomers794728425
Maprs794728425
PheGenIrs794728425
Biobankrs794728425
1000 genomesrs794728425
hgdprs794728425
ensemblrs794728425
gopubmedrs794728425
geneviewrs794728425
scholarrs794728425
googlers794728425
pharmgkbrs794728425
gwascentralrs794728425
openSNPrs794728425
23andMers794728425
23andMe allrs794728425
SNP Nexus

SNPshotrs794728425
SNPdbers794728425
MSV3drs794728425
GWAS Ctlgrs794728425
Max Magnitude0
ClinVar
Risk rs794728425(CGGCCAGCTCCCATCGCCCC;CGGCCAGCTCCCATCGCCCC)
Alt rs794728425(CGGCCAGCTCCCATCGCCCC;CGGCCAGCTCCCATCGCCCC)
Reference Rs794728425(-;-)
Significance Pathogenic
Disease Cardiac arrhythmia Long QT syndrome
Variation info
Gene KCNH2
CLNDBN Cardiac arrhythmia Long QT syndrome
Reversed 1
HGVS NC_000007.13:g.150655309_150655328dup20
CLNSRC
CLNACC RCV000181963.1, RCV000232953.2,