Have questions? Visit https://www.reddit.com/r/SNPedia

rs794726792

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(GATACCTTCAGTTGGGCTTT;GATACCTTCAGTTGGGCTTT) 0 common in clinvar
Make rs794726792(-;-)
Make rs794726792(-;GATACCTTCAGTTGGGCTTT)
ReferenceGRCh38.p2 38.2/146
Chromosome2
Position166047682
GeneSCN1A
is asnp
is mentioned by
dbSNPrs794726792
dbSNP (old)rs794726792
ClinGenrs794726792
ebirs794726792
HLIrs794726792
Exacrs794726792
Varsomers794726792
Maprs794726792
PheGenIrs794726792
Biobankrs794726792
1000 genomesrs794726792
hgdprs794726792
ensemblrs794726792
gopubmedrs794726792
geneviewrs794726792
scholarrs794726792
googlers794726792
pharmgkbrs794726792
gwascentralrs794726792
openSNPrs794726792
23andMers794726792
23andMe allrs794726792
SNP Nexus

SNPshotrs794726792
SNPdbers794726792
MSV3drs794726792
GWAS Ctlgrs794726792
Max Magnitude0
ClinVar
Risk rs794726792(-;-)
Alt rs794726792(-;-)
Reference Rs794726792(GATACCTTCAGTTGGGCTTT;GATACCTTCAGTTGGGCTTT)
Significance Pathogenic
Disease Severe myoclonic epilepsy in infancy
Variation info
Gene SCN1A
CLNDBN Severe myoclonic epilepsy in infancy
Reversed 1
HGVS NC_000002.11:g.166904192_166904211del20
CLNSRC Peking University
CLNACC RCV000180908.1,