Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205876

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(TAAAGCAAGACCGAGAGCACCTGT;TAAAGCAAGACCGAGAGCACCTGT) 0 common in clinvar
Make rs786205876(-;-)
Make rs786205876(-;TAAAGCAAGACCGAGAGCACCTGT)
ReferenceGRCh38.p2 38.2/146
Chromosome7
Position75986178
GenePOR
is asnp
is mentioned by
dbSNPrs786205876
dbSNP (old)rs786205876
ClinGenrs786205876
ebirs786205876
HLIrs786205876
Exacrs786205876
Gnomadrs786205876
Varsomers786205876
Maprs786205876
PheGenIrs786205876
Biobankrs786205876
1000 genomesrs786205876
hgdprs786205876
ensemblrs786205876
gopubmedrs786205876
geneviewrs786205876
scholarrs786205876
googlers786205876
pharmgkbrs786205876
gwascentralrs786205876
openSNPrs786205876
23andMers786205876
23andMe allrs786205876
SNP Nexus

SNPshotrs786205876
SNPdbers786205876
MSV3drs786205876
GWAS Ctlgrs786205876
Max Magnitude0
ClinVar
Risk rs786205876(-;-)
Alt rs786205876(-;-)
Reference Rs786205876(TAAAGCAAGACCGAGAGCACCTGT;TAAAGCAAGACCGAGAGCACCTGT)
Significance Pathogenic
Disease Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis
Variation info
Gene POR
CLNDBN Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis
Reversed 0
HGVS NC_000007.13:g.75615496_75615519del24
CLNSRC OMIM Allelic Variant
CLNACC RCV000018412.25,