Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205054

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(GTGCCAGGCTCTGGCACAGGT;GTGCCAGGCTCTGGCACAGGT) 0 common in clinvar
Make rs786205054(-;-)
Make rs786205054(-;GTGCCAGGCTCTGGCACAGGT)
ReferenceGRCh38.p2 38.2/146
Chromosome3
Position98592996
GeneCPOX
is asnp
is mentioned by
dbSNPrs786205054
dbSNP (old)rs786205054
ClinGenrs786205054
ebirs786205054
HLIrs786205054
Exacrs786205054
Gnomadrs786205054
Varsomers786205054
Maprs786205054
PheGenIrs786205054
Biobankrs786205054
1000 genomesrs786205054
hgdprs786205054
ensemblrs786205054
gopubmedrs786205054
geneviewrs786205054
scholarrs786205054
googlers786205054
pharmgkbrs786205054
gwascentralrs786205054
openSNPrs786205054
23andMers786205054
23andMe allrs786205054
SNP Nexus

SNPshotrs786205054
SNPdbers786205054
MSV3drs786205054
GWAS Ctlgrs786205054
Max Magnitude0
ClinVar
Risk rs786205054(-;-)
Alt rs786205054(-;-)
Reference Rs786205054(GTGCCAGGCTCTGGCACAGGT;GTGCCAGGCTCTGGCACAGGT)
Significance Pathogenic
Disease Coproporphyria
Variation info
Gene CPOX
CLNDBN Coproporphyria
Reversed 1
HGVS NC_000003.11:g.98311840_98311860del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000000484.4,