Have questions? Visit https://www.reddit.com/r/SNPedia

rs786204964

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(GTCTCACCACAGATCTAACAGC;GTCTCACCACAGATCTAACAGC) 0 common in clinvar
Make rs786204964(-;-)
Make rs786204964(-;GTCTCACCACAGATCTAACAGC)
ReferenceGRCh38.p2 38.2/146
ChromosomeX
Position18603932
GeneCDKL5
is asnp
is mentioned by
dbSNPrs786204964
dbSNP (old)rs786204964
ClinGenrs786204964
ebirs786204964
HLIrs786204964
Exacrs786204964
Gnomadrs786204964
Varsomers786204964
Maprs786204964
PheGenIrs786204964
Biobankrs786204964
1000 genomesrs786204964
hgdprs786204964
ensemblrs786204964
gopubmedrs786204964
geneviewrs786204964
scholarrs786204964
googlers786204964
pharmgkbrs786204964
gwascentralrs786204964
openSNPrs786204964
23andMers786204964
23andMe allrs786204964
SNP Nexus

SNPshotrs786204964
SNPdbers786204964
MSV3drs786204964
GWAS Ctlgrs786204964
Max Magnitude0
ClinVar
Risk rs786204964(-;-)
Alt rs786204964(-;-)
Reference Rs786204964(GTCTCACCACAGATCTAACAGC;GTCTCACCACAGATCTAACAGC)
Significance Pathogenic
Disease Early infantile epileptic encephalopathy 2
Variation info
Gene CDKL5
CLNDBN Early infantile epileptic encephalopathy 2
Reversed 0
HGVS NC_000023.10:g.18622052_18622073del22
CLNSRC RettBASE (CDKL5)
CLNACC RCV000169991.1,