Have questions? Visit https://www.reddit.com/r/SNPedia

rs786200912

From SNPedia

ClinVar
Risk rs786200912(AATTGAGATGGATGACTCCAGATTCTATCATTGA;AATTGAGATGGATGACTCCAGATTCTATCATTGA)
Alt rs786200912(AATTGAGATGGATGACTCCAGATTCTATCATTGA;AATTGAGATGGATGACTCCAGATTCTATCATTGA)
Reference Rs786200912(-;-)
Significance Pathogenic
Disease Paroxysmal nocturnal hemoglobinuria 1
Variation info
Gene PIGA
CLNDBN Paroxysmal nocturnal hemoglobinuria 1
Reversed 1
HGVS NC_000023.10:g.15339727_15339728insTCAATGATAGAATCTGGAGTCATCCATCTCAATT
CLNSRC OMIM Allelic Variant
CLNACC RCV000010644.3,