Have questions? Visit https://www.reddit.com/r/SNPedia

rs74315156

From SNPedia

Merged intors387906353
Orientationminus
Stabilizedminus
Geno Mag Summary
(AAACGCTGTTTGAGCAGCAGAACATGTACAGGC;AAACGCTGTTTGAGCAGCAGAACATGTACAGGC) 0 common in clinvar
Make rs74315156(-;-)
Make rs74315156(-;AAACGCTGTTTGAGCAGCAGAACATGTACAGGC)
ReferenceGRCh38 38.1/141
Chromosome16
Position16202057
GeneABCC6
is asnp
is mentioned by
dbSNPrs74315156
dbSNP (old)rs74315156
ClinGenrs74315156
ebirs74315156
HLIrs74315156
Exacrs74315156
Gnomadrs74315156
Varsomers74315156
Maprs74315156
PheGenIrs74315156
Biobankrs74315156
1000 genomesrs74315156
hgdprs74315156
ensemblrs74315156
gopubmedrs74315156
geneviewrs74315156
scholarrs74315156
googlers74315156
pharmgkbrs74315156
gwascentralrs74315156
openSNPrs74315156
23andMers74315156
23andMe allrs74315156
SNP Nexus

SNPshotrs74315156
SNPdbers74315156
MSV3drs74315156
GWAS Ctlgrs74315156
StatusMerged into rs387906353
Max Magnitude0
ClinVar
Risk
Alt
Reference Rs74315156(AAACGCTGTTTGAGCAGCAGAACATGTACAGGC;AAACGCTGTTTGAGCAGCAGAACATGTACAGGC)
Significance Untested
Disease
Variation info
Gene ABCC6
CLNDBN
Reversed 1
HGVS NC_000016.9:g.16295914_16295946del33
CLNSRC
CLNACC


[PMID 15086542] Novel ABCC6 mutations in pseudoxanthoma elasticum.