Have questions? Visit https://www.reddit.com/r/SNPedia

rs730880264

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(CCC;CCC) 0 common in clinvar
Make rs730880264(CCC;GGGCTAAAAGTACTGTTGGGG)
Make rs730880264(GGGCTAAAAGTACTGTTGGGG;GGGCTAAAAGTACTGTTGGGG)
ReferenceGRCh38.p2 38.2/144
Chromosome17
Position19663333
GeneALDH3A2
is asnp
is mentioned by
dbSNPrs730880264
dbSNP (old)rs730880264
ClinGenrs730880264
ebirs730880264
HLIrs730880264
Exacrs730880264
Gnomadrs730880264
Varsomers730880264
Maprs730880264
PheGenIrs730880264
Biobankrs730880264
1000 genomesrs730880264
hgdprs730880264
ensemblrs730880264
gopubmedrs730880264
geneviewrs730880264
scholarrs730880264
googlers730880264
pharmgkbrs730880264
gwascentralrs730880264
openSNPrs730880264
23andMers730880264
23andMe allrs730880264
SNP Nexus

SNPshotrs730880264
SNPdbers730880264
MSV3drs730880264
GWAS Ctlgrs730880264
Max Magnitude0
ClinVar
Risk rs730880264(GGGCTAAAAGTACTGTTGGGG;GGGCTAAAAGTACTGTTGGGG)
Alt rs730880264(GGGCTAAAAGTACTGTTGGGG;GGGCTAAAAGTACTGTTGGGG)
Reference Rs730880264(CCC;CCC)
Significance Pathogenic
Disease Sjögren-Larsson syndrome
Variation info
Gene ALDH3A2
CLNDBN Sjögren-Larsson syndrome
Reversed 0
HGVS NC_000017.10:g.19566646_19566648delCCCinsGGGCTAAAAGTACTGTTGGGG
CLNSRC OMIM Allelic Variant
CLNACC RCV000001705.3,