Have questions? Visit https://www.reddit.com/r/SNPedia

rs727503187

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(CGTGGTGTACGAGATGCGCGTC;CGTGGTGTACGAGATGCGCGTC) 0 common in clinvar
Make rs727503187(-;-)
Make rs727503187(-;CGTGGTGTACGAGATGCGCGTC)
ReferenceGRCh38.p2 38.2/144
Chromosome11
Position47337455
GeneMYBPC3
is asnp
is mentioned by
dbSNPrs727503187
dbSNP (old)rs727503187
ClinGenrs727503187
ebirs727503187
HLIrs727503187
Exacrs727503187
Gnomadrs727503187
Varsomers727503187
Maprs727503187
PheGenIrs727503187
Biobankrs727503187
1000 genomesrs727503187
hgdprs727503187
ensemblrs727503187
gopubmedrs727503187
geneviewrs727503187
scholarrs727503187
googlers727503187
pharmgkbrs727503187
gwascentralrs727503187
openSNPrs727503187
23andMers727503187
23andMe allrs727503187
SNP Nexus

SNPshotrs727503187
SNPdbers727503187
MSV3drs727503187
GWAS Ctlgrs727503187
Max Magnitude0
ClinVar
Risk rs727503187(-;-)
Alt rs727503187(-;-)
Reference Rs727503187(CGTGGTGTACGAGATGCGCGTC;CGTGGTGTACGAGATGCGCGTC)
Significance Pathogenic
Disease Primary familial hypertrophic cardiomyopathy
Variation info
Gene MYBPC3
CLNDBN Primary familial hypertrophic cardiomyopathy
Reversed 1
HGVS NC_000011.9:g.47359006_47359027del22
CLNSRC
CLNACC RCV000151093.1,