Have questions? Visit https://www.reddit.com/r/SNPedia

rs727502975

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(TGGAGCGCGGGGGCGGCGCTG;TGGAGCGCGGGGGCGGCGCTG) 0 common in clinvar
Make rs727502975(-;-)
Make rs727502975(-;TGGAGCGCGGGGGCGGCGCTG)
ReferenceGRCh38.p2 38.2/144
Chromosome5
Position13810180
GeneDNAH5
is asnp
is mentioned by
dbSNPrs727502975
dbSNP (old)rs727502975
ClinGenrs727502975
ebirs727502975
HLIrs727502975
Exacrs727502975
Gnomadrs727502975
Varsomers727502975
Maprs727502975
PheGenIrs727502975
Biobankrs727502975
1000 genomesrs727502975
hgdprs727502975
ensemblrs727502975
gopubmedrs727502975
geneviewrs727502975
scholarrs727502975
googlers727502975
pharmgkbrs727502975
gwascentralrs727502975
openSNPrs727502975
23andMers727502975
23andMe allrs727502975
SNP Nexus

SNPshotrs727502975
SNPdbers727502975
MSV3drs727502975
GWAS Ctlgrs727502975
Max Magnitude0
ClinVar
Risk rs727502975(-;-)
Alt rs727502975(-;-)
Reference Rs727502975(TGGAGCGCGGGGGCGGCGCTG;TGGAGCGCGGGGGCGGCGCTG)
Significance Probable-Pathogenic
Disease Primary ciliary dyskinesia
Variation info
Gene DNAH5
CLNDBN Primary ciliary dyskinesia
Reversed 1
HGVS NC_000005.9:g.13810289_13810309del21
CLNSRC
CLNACC RCV000150472.1,