Have questions? Visit https://www.reddit.com/r/SNPedia

rs63751076

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT;GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT) 0 common in clinvar
(TT;TT) 0 common in clinvar
Make rs63751076(-;-)
Make rs63751076(-;GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT)
ReferenceGRCh38 38.1/141
Chromosome11
Position5226903
GeneHBB
is asnp
is mentioned by
dbSNPrs63751076
dbSNP (old)rs63751076
ClinGenrs63751076
ebirs63751076
HLIrs63751076
Exacrs63751076
Gnomadrs63751076
Varsomers63751076
Maprs63751076
PheGenIrs63751076
Biobankrs63751076
1000 genomesrs63751076
hgdprs63751076
ensemblrs63751076
gopubmedrs63751076
geneviewrs63751076
scholarrs63751076
googlers63751076
pharmgkbrs63751076
gwascentralrs63751076
openSNPrs63751076
23andMers63751076
23andMe allrs63751076
SNP Nexus

SNPshotrs63751076
SNPdbers63751076
MSV3drs63751076
GWAS Ctlgrs63751076
Max Magnitude0
OMIM141900
Desc
Variant0355
Relatedalso
ClinVar
Risk rs63751076(-;-)
Alt rs63751076(-;-)
Reference Rs63751076(GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT;GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT)
Significance Pathogenic
Disease beta^0^ Thalassemia
Variation info
Gene HBB
CLNDBN beta^0^ Thalassemia
Reversed 1
HGVS NC_000011.9:g.5248133_5248176del44
CLNSRC HBVAR OMIM Allelic Variant
CLNACC RCV000016703.24,


[PMID 2753736] Characterization of three types of beta zero-thalassemia resulting from a partial deletion of the beta-globin gene.