Have questions? Visit https://www.reddit.com/r/SNPedia

rs606231139

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(AATCCCCTGTTGGGGGCCTCAC;AATCCCCTGTTGGGGGCCTCAC) 0 common in clinvar
(AATCCCCTGTTGGGGGCCTCAC;TTG) 3 Carrier of a coenzyme Q10 deficiency mutation
(TTG;TTG) 5.6 Coenzyme Q10 Deficiency; severity varies
ReferenceGRCh38.p2 38.2/144
Chromosome1
Position226965322
GeneADCK3, COQ8A
is asnp
is mentioned by
dbSNPrs606231139
dbSNP (old)rs606231139
ClinGenrs606231139
ebirs606231139
HLIrs606231139
Exacrs606231139
Gnomadrs606231139
Varsomers606231139
Maprs606231139
PheGenIrs606231139
Biobankrs606231139
1000 genomesrs606231139
hgdprs606231139
ensemblrs606231139
gopubmedrs606231139
geneviewrs606231139
scholarrs606231139
googlers606231139
pharmgkbrs606231139
gwascentralrs606231139
openSNPrs606231139
23andMers606231139
23andMe allrs606231139
SNP Nexus

SNPshotrs606231139
SNPdbers606231139
MSV3drs606231139
GWAS Ctlgrs606231139
Max Magnitude5.6
ClinVar
Risk Rs606231139(TTG;TTG)
Alt Rs606231139(TTG;TTG)
Reference Rs606231139(AATCCCCTGTTGGGGGCCTCAC;AATCCCCTGTTGGGGGCCTCAC)
Significance Pathogenic
Disease Coenzyme Q10 deficiency
Variation info
Gene COQ8A ADCK3
CLNDBN Coenzyme Q10 deficiency, primary, 4
Reversed 0
HGVS NC_000001.10:g.227153023_227153044del22insTTG
CLNSRC OMIM Allelic Variant
CLNACC RCV000003827.5,