Have questions? Visit https://www.reddit.com/r/SNPedia

rs587781442

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs587781442(-;GACATTTTTCCTACCACTTC)
Make rs587781442(GACATTTTTCCTACCACTTC;GACATTTTTCCTACCACTTC)
ReferenceGRCh38.p2 38.2/144
Chromosome11
Position94435846
GeneMRE11A
is asnp
is mentioned by
dbSNPrs587781442
dbSNP (old)rs587781442
ClinGenrs587781442
ebirs587781442
HLIrs587781442
Exacrs587781442
Gnomadrs587781442
Varsomers587781442
Maprs587781442
PheGenIrs587781442
Biobankrs587781442
1000 genomesrs587781442
hgdprs587781442
ensemblrs587781442
gopubmedrs587781442
geneviewrs587781442
scholarrs587781442
googlers587781442
pharmgkbrs587781442
gwascentralrs587781442
openSNPrs587781442
23andMers587781442
23andMe allrs587781442
SNP Nexus

SNPshotrs587781442
SNPdbers587781442
MSV3drs587781442
GWAS Ctlgrs587781442
Max Magnitude0
ClinVar
Risk rs587781442(GACATTTTTCCTACCACTTC;GACATTTTTCCTACCACTTC)
Alt rs587781442(GACATTTTTCCTACCACTTC;GACATTTTTCCTACCACTTC)
Reference Rs587781442(-;-)
Significance Other
Disease Hereditary cancer-predisposing syndrome Tumor susceptibility linked to germline BAP1 mutations
Variation info
Gene MRE11A
CLNDBN Hereditary cancer-predisposing syndrome Tumor susceptibility linked to germline BAP1 mutations
Reversed 1
HGVS NC_000011.9:g.94169013_94169032dup20
CLNSRC
CLNACC RCV000129354.4, RCV000219080.1,