Have questions? Visit https://www.reddit.com/r/SNPedia

rs587780024

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs587780024(-;TGAACAGGAAGAAAAGTATG)
Make rs587780024(TGAACAGGAAGAAAAGTATG;TGAACAGGAAGAAAAGTATG)
ReferenceGRCh38.p2 38.2/144
Chromosome2
Position214730457
GeneBARD1
is asnp
is mentioned by
dbSNPrs587780024
dbSNP (old)rs587780024
ClinGenrs587780024
ebirs587780024
HLIrs587780024
Exacrs587780024
Varsomers587780024
Maprs587780024
PheGenIrs587780024
Biobankrs587780024
1000 genomesrs587780024
hgdprs587780024
ensemblrs587780024
gopubmedrs587780024
geneviewrs587780024
scholarrs587780024
googlers587780024
pharmgkbrs587780024
gwascentralrs587780024
openSNPrs587780024
23andMers587780024
23andMe allrs587780024
SNP Nexus

SNPshotrs587780024
SNPdbers587780024
MSV3drs587780024
GWAS Ctlgrs587780024
Max Magnitude0
ClinVar
Risk rs587780024(TGAACAGGAAGAAAAGTATG;TGAACAGGAAGAAAAGTATG)
Alt rs587780024(TGAACAGGAAGAAAAGTATG;TGAACAGGAAGAAAAGTATG)
Reference Rs587780024(-;-)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome Familial cancer of breast not provided
Variation info
Gene BARD1
CLNDBN Hereditary cancer-predisposing syndrome Familial cancer of breast not provided
Reversed 1
HGVS NC_000002.11:g.215595182_215595201dup20
CLNSRC
CLNACC RCV000115621.5, RCV000200198.3, RCV000486214.1,