Have questions? Visit https://www.reddit.com/r/SNPedia

rs587776524

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs587776524(-;GGCCAGGGCTCATGAAAGTTCCA)
Make rs587776524(GGCCAGGGCTCATGAAAGTTCCA;GGCCAGGGCTCATGAAAGTTCCA)
ReferenceGRCh38 38.1/142
Chromosome3
Position33068960
GeneGLB1
is asnp
is mentioned by
dbSNPrs587776524
dbSNP (old)rs587776524
ClinGenrs587776524
ebirs587776524
HLIrs587776524
Exacrs587776524
Gnomadrs587776524
Varsomers587776524
Maprs587776524
PheGenIrs587776524
Biobankrs587776524
1000 genomesrs587776524
hgdprs587776524
ensemblrs587776524
gopubmedrs587776524
geneviewrs587776524
scholarrs587776524
googlers587776524
pharmgkbrs587776524
gwascentralrs587776524
openSNPrs587776524
23andMers587776524
23andMe allrs587776524
SNP Nexus

SNPshotrs587776524
SNPdbers587776524
MSV3drs587776524
GWAS Ctlgrs587776524
Max Magnitude0
ClinVar
Risk rs587776524(GGCCAGGGCTCATGAAAGTTCCA;GGCCAGGGCTCATGAAAGTTCCA)
Alt rs587776524(GGCCAGGGCTCATGAAAGTTCCA;GGCCAGGGCTCATGAAAGTTCCA)
Reference Rs587776524(-;-)
Significance Pathogenic
Disease Infantile GM1 gangliosidosis
Variation info
Gene TMPPE GLB1
CLNDBN Infantile GM1 gangliosidosis
Reversed 0
HGVS NC_000003.11:g.33110430_33110452dup23
CLNSRC OMIM Allelic Variant
CLNACC RCV000000983.2,