Have questions? Visit https://www.reddit.com/r/SNPedia

rs398124628

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs398124628(-;ACAGCCACCGCTGCAGCTGC)
Make rs398124628(ACAGCCACCGCTGCAGCTGC;ACAGCCACCGCTGCAGCTGC)
ReferenceGRCh38.p2 38.2/144
ChromosomeX
Position48791282
GeneGATA1
is asnp
is mentioned by
dbSNPrs398124628
dbSNP (old)rs398124628
ClinGenrs398124628
ebirs398124628
HLIrs398124628
Exacrs398124628
Varsomers398124628
Maprs398124628
PheGenIrs398124628
Biobankrs398124628
1000 genomesrs398124628
hgdprs398124628
ensemblrs398124628
gopubmedrs398124628
geneviewrs398124628
scholarrs398124628
googlers398124628
pharmgkbrs398124628
gwascentralrs398124628
openSNPrs398124628
23andMers398124628
23andMe allrs398124628
SNP Nexus

SNPshotrs398124628
SNPdbers398124628
MSV3drs398124628
GWAS Ctlgrs398124628
Max Magnitude0
ClinVar
Risk rs398124628(GCACAGCCACCGCTGCAGCT;GCACAGCCACCGCTGCAGCT)
Alt rs398124628(GCACAGCCACCGCTGCAGCT;GCACAGCCACCGCTGCAGCT)
Reference Rs398124628(-;-)
Significance Pathogenic
Disease Acute megakaryoblastic leukemia
Variation info
Gene GATA1
CLNDBN Acute megakaryoblastic leukemia
Reversed 0
HGVS NC_000023.10:g.48649670_48649689dup20
CLNSRC OMIM Allelic Variant
CLNACC RCV000011174.3,