Have questions? Visit https://www.reddit.com/r/SNPedia

rs398124542

From SNPedia

ClinVar
Risk rs398124542(AGCCCCTGTGTTGCCAGAGAGTACAGAA;AGCCCCTGTGTTGCCAGAGAGTACAGAA)
Alt rs398124542(AGCCCCTGTGTTGCCAGAGAGTACAGAA;AGCCCCTGTGTTGCCAGAGAGTACAGAA)
Reference Rs398124542(-;-)
Significance Pathogenic
Disease not provided Multiple fibrofolliculomas Hereditary cancer-predisposing syndrome
Variation info
Gene FLCN
CLNDBN not provided Multiple fibrofolliculomas Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000017.10:g.17122441_17122468dup28
CLNSRC HGMD OMIM Allelic Variant
CLNACC RCV000082645.3, RCV000239656.3, RCV000492117.1,