Have questions? Visit https://www.reddit.com/r/SNPedia

rs398124511

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs398124511(-;AGCCGCGGCCGCGGCCGCCGCGGC)
Make rs398124511(AGCCGCGGCCGCGGCCGCCGCGGC;AGCCGCGGCCGCGGCCGCCGCGGC)
ReferenceGRCh38 38.1/141
ChromosomeX
Position25013530
GeneARX
is asnp
is mentioned by
dbSNPrs398124511
dbSNP (old)rs398124511
ClinGenrs398124511
ebirs398124511
HLIrs398124511
Exacrs398124511
Varsomers398124511
Maprs398124511
PheGenIrs398124511
Biobankrs398124511
1000 genomesrs398124511
hgdprs398124511
ensemblrs398124511
gopubmedrs398124511
geneviewrs398124511
scholarrs398124511
googlers398124511
pharmgkbrs398124511
gwascentralrs398124511
openSNPrs398124511
23andMers398124511
23andMe allrs398124511
SNP Nexus

SNPshotrs398124511
SNPdbers398124511
MSV3drs398124511
GWAS Ctlgrs398124511
Max Magnitude0
ClinVar
Risk rs398124511(AGCCGCGGCCGCGGCCGCCGCGGC;AGCCGCGGCCGCGGCCGCCGCGGC)
Alt rs398124511(AGCCGCGGCCGCGGCCGCCGCGGC;AGCCGCGGCCGCGGCCGCCGCGGC)
Reference Rs398124511(-;-)
Significance Pathogenic
Disease not provided Lissencephaly 2 Mental retardation
Variation info
Gene ARX
CLNDBN not provided Lissencephaly 2, X-linked Mental retardation, with or without seizures, ARX-related, X-linked
Reversed 1
HGVS NC_000023.10:g.25031648_25031671dup24
CLNSRC HGMD
CLNACC RCV000082605.4, RCV000192670.2, RCV000348945.1,