Have questions? Visit https://www.reddit.com/r/SNPedia

rs397518417

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(TAGGCGGGATGGTGCCGCTGTGC;TAGGCGGGATGGTGCCGCTGTGC) 0 common in clinvar
Make rs397518417(-;-)
Make rs397518417(-;TAGGCGGGATGGTGCCGCTGTGC)
ReferenceGRCh38 38.1/141
Chromosome5
Position53109715
GeneLOC257396, MOCS2
is asnp
is mentioned by
dbSNPrs397518417
dbSNP (old)rs397518417
ClinGenrs397518417
ebirs397518417
HLIrs397518417
Exacrs397518417
Gnomadrs397518417
Varsomers397518417
Maprs397518417
PheGenIrs397518417
Biobankrs397518417
1000 genomesrs397518417
hgdprs397518417
ensemblrs397518417
gopubmedrs397518417
geneviewrs397518417
scholarrs397518417
googlers397518417
pharmgkbrs397518417
gwascentralrs397518417
openSNPrs397518417
23andMers397518417
23andMe allrs397518417
SNP Nexus

SNPshotrs397518417
SNPdbers397518417
MSV3drs397518417
GWAS Ctlgrs397518417
Max Magnitude0
ClinVar
Risk rs397518417(-;-)
Alt rs397518417(-;-)
Reference Rs397518417(TAGGCGGGATGGTGCCGCTGTGC;TAGGCGGGATGGTGCCGCTGTGC)
Significance Pathogenic
Disease Molybdenum cofactor deficiency
Variation info
Gene MOCS2 LOC257396
CLNDBN Molybdenum cofactor deficiency, complementation group B
Reversed 1
HGVS NC_000005.9:g.52405545_52405567del23
CLNSRC OMIM Allelic Variant
CLNACC RCV000006490.3,