Have questions? Visit https://www.reddit.com/r/SNPedia

rs397514818

From SNPedia

Merged intors118203557
Orientationminus
Stabilizedminus
Geno Mag Summary
(CAGTGCTGATGAAAGCCCTGCGG;CAGTGCTGATGAAAGCCCTGCGG) 0 common in clinvar
Make rs397514818(-;-)
Make rs397514818(-;CAGTGCTGATGAAAGCCCTGCGG)
ReferenceGRCh38.p2 38.2/146
Chromosome9
Position132905876
GeneTSC1
is asnp
is mentioned by
dbSNPrs397514818
dbSNP (old)rs397514818
ClinGenrs397514818
ebirs397514818
HLIrs397514818
Exacrs397514818
Gnomadrs397514818
Varsomers397514818
Maprs397514818
PheGenIrs397514818
Biobankrs397514818
1000 genomesrs397514818
hgdprs397514818
ensemblrs397514818
gopubmedrs397514818
geneviewrs397514818
scholarrs397514818
googlers397514818
pharmgkbrs397514818
gwascentralrs397514818
openSNPrs397514818
23andMers397514818
23andMe allrs397514818
SNP Nexus

SNPshotrs397514818
SNPdbers397514818
MSV3drs397514818
GWAS Ctlgrs397514818
StatusMerged into rs118203557
Max Magnitude0
ClinVar
Risk
Alt
Reference Rs397514818(CAGTGCTGATGAAAGCCCTGCGG;CAGTGCTGATGAAAGCCCTGCGG)
Significance Pathogenic
Disease Tuberous sclerosis 1 Tuberous sclerosis syndrome
Variation info
Gene TSC1
CLNDBN Tuberous sclerosis 1 Tuberous sclerosis syndrome
Reversed 1
HGVS NC_000009.11:g.135781263_135781285del23
CLNSRC OMIM Allelic Variant Tuberous sclerosis database (TSC1)
CLNACC RCV000005407.2, RCV000054946.1,