Have questions? Visit https://www.reddit.com/r/SNPedia

rs397507182

From SNPedia

ClinVar
Risk rs397507182(-;-)
Alt rs397507182(-;-)
Reference Rs397507182(TTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAATG;TTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAATG)
Significance Pathogenic
Disease Breast-ovarian cancer
Variation info
Gene BRCA1
CLNDBN Breast-ovarian cancer, familial 1
Reversed 1
HGVS NC_000017.10:g.41246331_41246373del43
CLNSRC ClinVar
CLNACC RCV000030977.3,