Have questions? Visit https://www.reddit.com/r/SNPedia

rs387906497

From SNPedia

ClinVar
Risk rs387906497(-;-)
Alt rs387906497(-;-)
Reference Rs387906497(GCAGCCAGCCCAGGTGACATGCCGGT;GCAGCCAGCCCAGGTGACATGCCGGT)
Significance Pathogenic
Disease Adrenoleukodystrophy
Variation info
Gene BCAP31
CLNDBN Adrenoleukodystrophy
Reversed 0
HGVS NC_000023.10:g.152990704_152990729del26
CLNSRC OMIM Allelic Variant
CLNACC RCV000012069.2,