Have questions? Visit https://www.reddit.com/r/SNPedia

rs387906493

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs387906493(-;GGGCCGCCGCGGCAGCCGCGGCCG)
Make rs387906493(GGGCCGCCGCGGCAGCCGCGGCCG;GGGCCGCCGCGGCAGCCGCGGCCG)
ReferenceGRCh38 38.1/141
ChromosomeX
Position25013543
GeneARX
is asnp
is mentioned by
dbSNPrs387906493
dbSNP (old)rs387906493
ClinGenrs387906493
ebirs387906493
HLIrs387906493
Exacrs387906493
Gnomadrs387906493
Varsomers387906493
Maprs387906493
PheGenIrs387906493
Biobankrs387906493
1000 genomesrs387906493
hgdprs387906493
ensemblrs387906493
gopubmedrs387906493
geneviewrs387906493
scholarrs387906493
googlers387906493
pharmgkbrs387906493
gwascentralrs387906493
openSNPrs387906493
23andMers387906493
23andMe allrs387906493
SNP Nexus

SNPshotrs387906493
SNPdbers387906493
MSV3drs387906493
GWAS Ctlgrs387906493
Max Magnitude0
ClinVar
Risk rs387906493(GGGCCGCCGCGGCAGCCGCGGCCG;GGGCCGCCGCGGCAGCCGCGGCCG)
Alt rs387906493(GGGCCGCCGCGGCAGCCGCGGCCG;GGGCCGCCGCGGCAGCCGCGGCCG)
Reference Rs387906493(-;-)
Significance Pathogenic
Disease Epileptic encephalopathy Mental retardation Partington X-linked mental retardation syndrome not provided
Variation info
Gene ARX
CLNDBN Epileptic encephalopathy, early infantile, 1 Mental retardation, with or without seizures, ARX-related, X-linked Partington X-linked mental retardation syndrome not provided
Reversed 1
HGVS NC_000023.10:g.25031661_25031684dup24
CLNSRC OMIM Allelic Variant
CLNACC RCV000011937.9, RCV000011938.9, RCV000033212.17, RCV000487265.1,