Have questions? Visit https://www.reddit.com/r/SNPedia

rs199473683

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(TTGTCCTGCCTTTCTATCCGA;TTGTCCTGCCTTTCTATCCGA) 0 common in clinvar
Make rs199473683(-;-)
Make rs199473683(-;TTGTCCTGCCTTTCTATCCGA)
ReferenceGRCh38 38.1/141
Chromosome17
Position8228228
GeneCTC1
is asnp
is mentioned by
dbSNPrs199473683
dbSNP (old)rs199473683
ClinGenrs199473683
ebirs199473683
HLIrs199473683
Exacrs199473683
Gnomadrs199473683
Varsomers199473683
Maprs199473683
PheGenIrs199473683
Biobankrs199473683
1000 genomesrs199473683
hgdprs199473683
ensemblrs199473683
gopubmedrs199473683
geneviewrs199473683
scholarrs199473683
googlers199473683
pharmgkbrs199473683
gwascentralrs199473683
openSNPrs199473683
23andMers199473683
23andMe allrs199473683
SNP Nexus

SNPshotrs199473683
SNPdbers199473683
MSV3drs199473683
GWAS Ctlgrs199473683
Max Magnitude0
ClinVar
Risk
Alt
Reference Rs199473683(TTGTCCTGCCTTTCTATCCGA;TTGTCCTGCCTTTCTATCCGA)
Significance Pathogenic
Disease Cerebroretinal microangiopathy with calcifications and cysts
Variation info
Gene CTC1
CLNDBN Cerebroretinal microangiopathy with calcifications and cysts
Reversed 1
HGVS NC_000017.10:g.8131546_8131566del21
CLNSRC
CLNACC


[PMID 22387016OA-icon.png] Mutations in CTC1, encoding the CTS telomere maintenance complex component 1, cause cerebroretinal microangiopathy with calcifications and cysts.