Have questions? Visit https://www.reddit.com/r/SNPedia

rs193302859

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 6.1 Mucolipidosis III gamma
(-;GAGGATGCTGGCTACTTAAAGACCCCAG) 3 Carrier of a mucolipidosis III gamma mutation
(GAGGATGCTGGCTACTTAAAGACCCCAG;GAGGATGCTGGCTACTTAAAGACCCCAG) 0 common in clinvar
ReferenceGRCh38 38.1/141
Chromosome16
Position1362641
GeneGNPTG
is asnp
is mentioned by
dbSNPrs193302859
dbSNP (old)rs193302859
ClinGenrs193302859
ebirs193302859
HLIrs193302859
Exacrs193302859
Gnomadrs193302859
Varsomers193302859
Maprs193302859
PheGenIrs193302859
Biobankrs193302859
1000 genomesrs193302859
hgdprs193302859
ensemblrs193302859
gopubmedrs193302859
geneviewrs193302859
scholarrs193302859
googlers193302859
pharmgkbrs193302859
gwascentralrs193302859
openSNPrs193302859
23andMers193302859
23andMe allrs193302859
SNP Nexus

SNPshotrs193302859
SNPdbers193302859
MSV3drs193302859
GWAS Ctlgrs193302859
Max Magnitude6.1
ClinVar
Risk Rs193302859(-;-)
Alt Rs193302859(-;-)
Reference Rs193302859(GAGGATGCTGGCTACTTAAAGACCCCAG;GAGGATGCTGGCTACTTAAAGACCCCAG)
Significance Pathogenic
Disease Mucolipidosis III Gamma
Variation info
Gene GNPTG
CLNDBN Mucolipidosis III Gamma
Reversed 0
HGVS NC_000016.9:g.1412642_1412669del28
CLNSRC OMIM Allelic Variant
CLNACC RCV000002930.3,