Have questions? Visit https://www.reddit.com/r/SNPedia

rs137853929

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(CAATCCGCGCGGCGGCCGCCGCC;CAATCCGCGCGGCGGCCGCCGCC) 0 common in clinvar
Make rs137853929(-;-)
Make rs137853929(-;CAATCCGCGCGGCGGCCGCCGCC)
ReferenceGRCh38 38.1/141
Chromosome19
Position18606604
GeneCRLF1
is asnp
is mentioned by
dbSNPrs137853929
dbSNP (old)rs137853929
ClinGenrs137853929
ebirs137853929
HLIrs137853929
Exacrs137853929
Gnomadrs137853929
Varsomers137853929
Maprs137853929
PheGenIrs137853929
Biobankrs137853929
1000 genomesrs137853929
hgdprs137853929
ensemblrs137853929
gopubmedrs137853929
geneviewrs137853929
scholarrs137853929
googlers137853929
pharmgkbrs137853929
gwascentralrs137853929
openSNPrs137853929
23andMers137853929
23andMe allrs137853929
SNP Nexus

SNPshotrs137853929
SNPdbers137853929
MSV3drs137853929
GWAS Ctlgrs137853929
Max Magnitude0
ClinVar
Risk rs137853929(-;-)
Alt rs137853929(-;-)
Reference Rs137853929(CAATCCGCGCGGCGGCCGCCGCC;CAATCCGCGCGGCGGCCGCCGCC)
Significance Pathogenic
Disease Cold-induced sweating syndrome 1
Variation info
Gene CRLF1
CLNDBN Cold-induced sweating syndrome 1
Reversed 1
HGVS NC_000019.9:g.18717414_18717436del23
CLNSRC ClinVar GeneReviews
CLNACC RCV000020616.1,