Have questions? Visit https://www.reddit.com/r/SNPedia

rs121913424

From SNPedia
Orientationplus
Stabilizedplus
Geno Mag Summary
(AATTAAGAGAAGCAACATCT;AATTAAGAGAAGCAACATCT) 0 common in clinvar
Make rs121913424(AATTAAGAGAAGCAACATCT;TC)
Make rs121913424(TC;TC)
ReferenceGRCh38.p2 38.2/144
Chromosome7
Position55174774
GeneEGFR
is asnp
is mentioned by
dbSNPrs121913424
dbSNP (old)rs121913424
ClinGenrs121913424
ebirs121913424
HLIrs121913424
Exacrs121913424
Gnomadrs121913424
Varsomers121913424
Maprs121913424
PheGenIrs121913424
Biobankrs121913424
1000 genomesrs121913424
hgdprs121913424
ensemblrs121913424
gopubmedrs121913424
geneviewrs121913424
scholarrs121913424
googlers121913424
pharmgkbrs121913424
gwascentralrs121913424
openSNPrs121913424
23andMers121913424
23andMe allrs121913424
SNP Nexus

SNPshotrs121913424
SNPdbers121913424
MSV3drs121913424
GWAS Ctlgrs121913424
Max Magnitude0
ClinVar
Risk rs121913424(TC;TC)
Alt rs121913424(TC;TC)
Reference Rs121913424(AATTAAGAGAAGCAACATCT;AATTAAGAGAAGCAACATCT)
Significance Drug-response
Disease Tyrosine kinase inhibitor response
Variation info
Gene EGFR
CLNDBN Tyrosine kinase inhibitor response
Reversed 0
HGVS NC_000007.13:g.55242467_55242486delinsTC
CLNSRC
CLNACC RCV000154445.1,