Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs121913424

From SNPedia

ClinVar
Risk rs121913424(TC;TC)
Alt rs121913424(TC;TC)
Reference Rs121913424(AATTAAGAGAAGCAACATCT;AATTAAGAGAAGCAACATCT)
Significance Drug-response
Disease Tyrosine kinase inhibitor response
Variation info
Gene EGFR
CLNDBN Tyrosine kinase inhibitor response
Reversed 0
HGVS NC_000007.13:g.55242467_55242486delinsTC
CLNSRC
CLNACC RCV000154445.1,