Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Geno Mag Summary
(-;TTCTACAACAAGAGCGAGGAT) 4 likely severe central core disease

Make rs118192169(-;-)
ReferenceGRCh38 38.1/141
is asnp
is mentioned by
dbSNP (old)rs118192169
1000 genomesrs118192169
23andMe allrs118192169
SNP Nexus

GWAS Ctlgrs118192169
Max Magnitude4
Risk rs118192169(-;-)
Alt rs118192169(-;-)
Significance Pathogenic
Disease Central core disease
Variation info
Gene RYR1
CLNDBN Central core disease
Reversed 0
HGVS NC_000019.9:g.39071085_39071105del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000013858.24,

[PMID 12566385] Clinical and functional effects of a deletion in a COOH-terminal lumenal loop of the skeletal muscle ryanodine receptor.