Have questions? Visit https://www.reddit.com/r/SNPedia

rs113994086

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(GTACTGATGGCTTTCTACCAG;GTACTGATGGCTTTCTACCAG) 0 common in clinvar
Make rs113994086(-;-)
Make rs113994086(-;GTACTGATGGCTTTCTACCAG)
ReferenceGRCh38 38.1/141
Chromosome3
Position184144597
GeneEIF2B5
is asnp
is mentioned by
dbSNPrs113994086
dbSNP (old)rs113994086
ClinGenrs113994086
ebirs113994086
HLIrs113994086
Exacrs113994086
Gnomadrs113994086
Varsomers113994086
Maprs113994086
PheGenIrs113994086
Biobankrs113994086
1000 genomesrs113994086
hgdprs113994086
ensemblrs113994086
gopubmedrs113994086
geneviewrs113994086
scholarrs113994086
googlers113994086
pharmgkbrs113994086
gwascentralrs113994086
openSNPrs113994086
23andMers113994086
23andMe allrs113994086
SNP Nexus

SNPshotrs113994086
SNPdbers113994086
MSV3drs113994086
GWAS Ctlgrs113994086
Max Magnitude0
ClinVar
Risk
Alt
Reference Rs113994086(GTACTGATGGCTTTCTACCAG;GTACTGATGGCTTTCTACCAG)
Significance Pathogenic
Disease Leukoencephalopathy with vanishing white matter
Variation info
Gene EIF2B5
CLNDBN Leukoencephalopathy with vanishing white matter
Reversed 0
HGVS NC_000003.11:g.183862385_183862405del21
CLNSRC
CLNACC


OMIM603896
Desc
Variant
Relatedalso