Have questions? Visit https://www.reddit.com/r/SNPedia

rs61276843

From SNPedia

Orientationplus
Stabilizedplus
Make rs61276843(-;-)
Make rs61276843(-;GAGAGAGGCGGCGCCCCGGGG)
Make rs61276843(GAGAGAGGCGGCGCCCCGGGG;GAGAGAGGCGGCGCCCCGGGG)
ReferenceGRCh37.p10 37.5/138
Chromosome22
Position26880005
GeneHPS4, SRRD
is asnp
is mentioned by
dbSNPrs61276843
dbSNP (old)rs61276843
ClinGenrs61276843
ebirs61276843
HLIrs61276843
Exacrs61276843
Varsomers61276843
Maprs61276843
PheGenIrs61276843
Biobankrs61276843
1000 genomesrs61276843
hgdprs61276843
ensemblrs61276843
gopubmedrs61276843
geneviewrs61276843
scholarrs61276843
googlers61276843
pharmgkbrs61276843
gwascentralrs61276843
openSNPrs61276843
23andMers61276843
23andMe allrs61276843
SNP Nexus

SNPshotrs61276843
SNPdbers61276843
MSV3drs61276843
GWAS Ctlgrs61276843
StatusDeleted
Max Magnitude

[PMID 23563589] An association study of the Hermansky-Pudlak syndrome type 4 gene in schizophrenic patients