Have questions? Visit https://www.reddit.com/r/SNPedia

rs3831317

From SNPedia

Orientationplus
Stabilizedplus
Make rs3831317(-;-)
Make rs3831317(-;AGACCATGGCCCCGCCCAGTCCCT)
Make rs3831317(AGACCATGGCCCCGCCCAGTCCCT;AGACCATGGCCCCGCCCAGTCCCT)
ReferenceGRCh38.p2 38.2/144
Chromosome1
Position203217846
GeneCHIT1
is asnp
is mentioned by
dbSNPrs3831317
dbSNP (old)rs3831317
ClinGenrs3831317
ebirs3831317
HLIrs3831317
Exacrs3831317
Varsomers3831317
Maprs3831317
PheGenIrs3831317
Biobankrs3831317
1000 genomesrs3831317
hgdprs3831317
ensemblrs3831317
gopubmedrs3831317
geneviewrs3831317
scholarrs3831317
googlers3831317
pharmgkbrs3831317
gwascentralrs3831317
openSNPrs3831317
23andMers3831317
23andMe allrs3831317
SNP Nexus

SNPshotrs3831317
SNPdbers3831317
MSV3drs3831317
GWAS Ctlgrs3831317
Max Magnitude

[PMID 26332238OA-icon.png] A Polymorphism in the Chitotriosidase Gene Associated with Risk of Mycetoma Due to Madurella mycetomatis Mycetoma-A Retrospective Study