rs4795541
| Orientation | plus |
| Stabilized | plus |
| Geno | Mag | Summary |
|---|---|---|
| (-;-) | normal | |
| (-;AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG) | complex; see details | |
| (AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG;AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG) | complex; see details |
| Reference | GRCh38 38.1/141 |
| Chromosome | 17 |
| Position | 30237299 |
| Gene | LOC105371720, SLC6A4 |
| is a | snp |
| is | mentioned by |
| dbSNP | rs4795541 |
| dbSNP (classic) | rs4795541 |
| ClinGen | rs4795541 |
| ebi | rs4795541 |
| HLI | rs4795541 |
| Exac | rs4795541 |
| Gnomad | rs4795541 |
| Varsome | rs4795541 |
| LitVar | rs4795541 |
| Map | rs4795541 |
| PheGenI | rs4795541 |
| Biobank | rs4795541 |
| 1000 genomes | rs4795541 |
| hgdp | rs4795541 |
| ensembl | rs4795541 |
| geneview | rs4795541 |
| scholar | rs4795541 |
| rs4795541 | |
| pharmgkb | rs4795541 |
| gwascentral | rs4795541 |
| openSNP | rs4795541 |
| 23andMe | rs4795541 |
| SNPshot | rs4795541 |
| SNPdbe | rs4795541 |
| MSV3d | rs4795541 |
| GWAS Ctlg | rs4795541 |
| Max Magnitude | 0 |
This SNP represents a polymorphic region consisting of an "in/del", i.e. either an insertion or a deletion, of 43 or 44 nucleotides. This SNP is commonly known as the 5-HTTLPR variant of the serotonin transporter SLC6A4 gene. The deletion allele is referred to as the "S" allele, the insertion allele is known as the "L" allele, and hence the genotypes are usually called the LL, SL, and SS genotypes in publications. Note, however, that this is actually a tri-allelic SNP, in that on occasion, a single nucleotide, usually a G, may be present at this position.
This SNP has been studied in many contexts, including the following:
- Anxiety related behaviours and disorders
- Depression
- Response to anti-depressant drugs
- Seasonality and seasonal affective disorder
- Suicide
- Premature ejaculation
- Men with the LL genotype ejaculate about twice as quickly as men with SS or SL genotypes on average, based on a study of 89 Dutch men who suffer from the primary form of premature ejaculation. [1]
- Attention deficit disorder
- Migraine
- Bipolar mood disorder
- Obsessive compulsive disorder
- Fibromyalgia
- Irritable bowel syndrome
It is beyond the current scope to summarize all the associations seen for this SNP, as well as the lack of replication reported in some follow-on studies.
[PMID 19487392] Serotonin Transporter Gene (SLC6A4) Promoter Polymorphisms and the Susceptibility to Posttraumatic Stress Disorder in the General Population
[PMID 20502016] Polymorphism C in the Serotonin Transporter Gene in Depression-Free Elderly Patients with Vascular Dementia
[PMID 17629953] Loudness dependence of auditory evoked potentials is not associated with polymorphisms or haplotypes in the serotonin transporter gene in a community-based sample of German healthy volunteers.
[PMID 18081710
] Multivariate permutation analysis associates multiple polymorphisms with subphenotypes of major depression.
[PMID 19721846] Candidate genes involved in neural plasticity and the risk for attention-deficit hyperactivity disorder: a meta-analysis of 8 common variants.
[PMID 19940176] Functional variation of the dopamine D2 receptor gene is associated with emotional control as well as brain activity and connectivity during emotion processing in humans.
[PMID 23728717] Common functional polymorphisms in SLC6A4 and COMT genes are associated with circadian phenotypes in a South American sample
