Rs333
| Orientation | plus |
| is a | snp |
| is | mentioned by |
| dbSNP | rs333 |
| PheGenI | rs333 |
| nextbio | rs333 |
| hapmap | rs333 |
| 1000 genomes | rs333 |
| hgdp | rs333 |
| ensembl | rs333 |
| gopubmed | rs333 |
| geneview | rs333 |
| scholar | rs333 |
| rs333 | |
| pharmgkb | rs333 |
| gwascentral | rs333 |
| openSNP | rs333 |
| 23andMe | rs333 |
| 23andMe all | rs333 |
| SNP Nexus | |
| SNPshot | rs333 |
| SNPdbe | rs333 |
| MSV3d | rs333 |
| Gene | CCR5 |
| Chromosome | 3 |
| Orientation | plus |
| Position | 46414947 |
| Reference | GRCh37 37.1/131 |
| Max Magnitude | 4 |
| Geno | Mag | Summary |
|---|---|---|
| (-;-) | 4 | very resistant to HIV |
| (-;GTCAGTATCAATTCTGGAAGAATTTCCAGACA) | 2 | resistant to HIV |
| (GTCAGTATCAATTCTGGAAGAATTTCCAGACA;GTCAGTATCAATTCTGGAAGAATTTCCAGACA) | 0 | common form |
The chemokine receptor gene CCR5 plays an important role in many immune-related processes. Delta 32 rs333, designating the CCR5-delta32 deletion of 32 nucleotides from within the gene, is perhaps the most famous allele of CCR5. 23andMe tests for this by the name I3003626.
Individuals carrying one copy of the delta 32 allele are somewhat resistant to infection by HIV, the virus that causes AIDS, and individuals with 2 copies (delta 32 homozygotes, ~1% of Caucasians) are almost completely immune to infection by HIV. [PMID 8898752] The delta 32 allele may have been selected for in European populations because it confers resistance to plague (Black Death) or smallpox. [1]
NEJM suggests decreased risk of type 1 diabetes (odds ratio, 0.54; 95% CI, 0.40 to 0.72; P=1.88x10–6 with 2 df).
Does the CCR5-delta32 mutation have an entirely positive/protective role?
Probably not. In patients with abdominal aortic aneurysm (AAA), the major risk is a sudden rupture - which is quite often fatal. Individuals with the delta 32 variant are more likely to have aneurysms than non-carriers, and among patients with aneurysms, delta 32 carriers are more likely to rupture than to be diagnosed in time for surgical repair. [PMID 15557916]
Tests for CCR-delta32 are offered by FamilyTreeDNA (FAQ), 23andme, and possibly other direct-to-consumer genetics testing companies.
[PMID 15726497] Gene-environment interaction effects on the development of immune responses in the 1st year of life.
[PMID 17327408] Prognostic significance of host immune gene polymorphisms in follicular lymphoma survival.
[PMID 17355643] Frequencies of single nucleotide polymorphisms in genes regulating inflammatory responses in a community-based population.
[PMID 17672867] Polymorphisms in chemokine receptor genes and susceptibility to Kawasaki disease.
[PMID 18633131] Host immune gene polymorphisms in combination with clinical and demographic factors predict late survival in diffuse large B-cell lymphoma patients in the pre-rituximab era.
[PMID 18805939] Functional genetic polymorphisms and female reproductive disorders: part II--endometriosis.
[PMID 19066394] Organochlorine exposure, immune gene variation, and risk of non-Hodgkin lymphoma.
[PMID 19073967] Shared and distinct genetic variants in type 1 diabetes and celiac disease.
[PMID 19131662] A meta-analysis of candidate gene polymorphisms and ischemic stroke in 6 study populations: association of lymphotoxin-alpha in nonhypertensive patients.
[PMID 19225544] Variation in the lymphotoxin-alpha/tumor necrosis factor locus modifies risk of erythema nodosum in sarcoidosis.
[PMID 19263529] Genetic risk factors in recurrent venous thromboembolism: A multilocus, population-based, prospective approach.
[PMID 19330901] Association of 77 polymorphisms in 52 candidate genes with blood pressure progression and incident hypertension: the Women's Genome Health Study.
[PMID 19559392] A candidate gene association study of 77 polymorphisms in migraine.
[PMID 20041166] Common genetic variation and the control of HIV-1 in humans.
[PMID 20206716] Genetic variation within the gene encoding the HIV-1 CCR5 coreceptor in two South African populations.
[PMID 20552027] Host and viral genetic correlates of clinical definitions of HIV-1 disease progression.
[PMID 21854194] Distribution of polymorphisms in cytochrome P450 2B6, histocompatibility complex P5, chemokine coreceptor 5, and interleukin 28B genes in inhabitants from the central area of Argentina.
[PMID 22474614] Host Genes Important to HIV Replication and Evolution.
| GET Evidence | |
|---|---|
| CCR5-S185Shift | |
| aa_change | Ser185Shift |
| aa_change_short | S185Shift |
| impact | protective |
| qualified_impact | Low clinical importance, protective |
| overall_frequency | 0.047619 |
| summary | Also known as CCR5-delta32, this variant is associated with resistance to many strains of HIV (but not all strains, only strains that use target the CCR5 protein). Heterozygotes are reported to have slower HIV progression, and homozygotes are very resistant to being infected by these strains. |
[PMID 23632061] CCR2 and CCR5 genes polymorphisms in benign prostatic hyperplasia and prostate cancer
