Rs333

From SNPedia
Jump to: navigation, search

Orientationplus
is asnp
is mentioned by
dbSNPrs333
PheGenIrs333
nextbiors333
hapmaprs333
1000 genomesrs333
hgdprs333
ensemblrs333
gopubmedrs333
geneviewrs333
scholarrs333
googlers333
pharmgkbrs333
gwascentralrs333
openSNPrs333
23andMers333
23andMe allrs333
SNP Nexus

SNPshotrs333
SNPdbers333
MSV3drs333
GeneCCR5, LOC102724297
Chromosome3
Orientationplus
Position46373456
ReferenceGRCh38 38.1/141
Max Magnitude4
Geno Mag Summary
(-;-) 4 very resistant to HIV
(-;GTCAGTATCAATTCTGGAAGAATTTCCAGACA) 2 resistant to HIV
(GTCAGTATCAATTCTGGAAGAATTTCCAGACA;GTCAGTATCAATTCTGGAAGAATTTCCAGACA) 0 common form

The chemokine receptor gene CCR5 plays an important role in many immune-related processes. Delta 32 rs333, designating the CCR5-delta32 deletion of 32 nucleotides from within the gene, is perhaps the most famous allele of CCR5. 23andMe tests for this by the name I3003626.

Individuals carrying one copy of the delta 32 allele are somewhat resistant to infection by HIV, the virus that causes AIDS, and individuals with 2 copies (delta 32 homozygotes, ~1% of Caucasians) are almost completely immune to infection by HIV. [PMID 8898752] The delta 32 allele may have been selected for in European populations because it confers resistance to plague (Black Death) or smallpox. [1]

NEJM suggests decreased risk of type 1 diabetes (odds ratio, 0.54; 95% CI, 0.40 to 0.72; P=1.88x10–6 with 2 df).

Does the CCR5-delta32 mutation have an entirely positive/protective role?

Probably not. In patients with abdominal aortic aneurysm (AAA), the major risk is a sudden rupture - which is quite often fatal. Individuals with the delta 32 variant are more likely to have aneurysms than non-carriers, and among patients with aneurysms, delta 32 carriers are more likely to rupture than to be diagnosed in time for surgical repair. [PMID 15557916]

Tests for CCR-delta32 are offered by FamilyTreeDNA (FAQ), 23andme, and possibly other direct-to-consumer genetics testing companies.


[PMID 15726497OA-icon.png] Gene-environment interaction effects on the development of immune responses in the 1st year of life.


[PMID 17327408OA-icon.png] Prognostic significance of host immune gene polymorphisms in follicular lymphoma survival.


[PMID 17355643OA-icon.png] Frequencies of single nucleotide polymorphisms in genes regulating inflammatory responses in a community-based population.


[PMID 17672867OA-icon.png] Polymorphisms in chemokine receptor genes and susceptibility to Kawasaki disease.


[PMID 18633131OA-icon.png] Host immune gene polymorphisms in combination with clinical and demographic factors predict late survival in diffuse large B-cell lymphoma patients in the pre-rituximab era.


[PMID 18805939OA-icon.png] Functional genetic polymorphisms and female reproductive disorders: part II--endometriosis.


[PMID 19066394OA-icon.png] Organochlorine exposure, immune gene variation, and risk of non-Hodgkin lymphoma.


[PMID 19073967OA-icon.png] Shared and distinct genetic variants in type 1 diabetes and celiac disease.


[PMID 19131662OA-icon.png] A meta-analysis of candidate gene polymorphisms and ischemic stroke in 6 study populations: association of lymphotoxin-alpha in nonhypertensive patients.


[PMID 19225544OA-icon.png] Variation in the lymphotoxin-alpha/tumor necrosis factor locus modifies risk of erythema nodosum in sarcoidosis.


[PMID 19263529OA-icon.png] Genetic risk factors in recurrent venous thromboembolism: A multilocus, population-based, prospective approach.


[PMID 19330901OA-icon.png] Association of 77 polymorphisms in 52 candidate genes with blood pressure progression and incident hypertension: the Women's Genome Health Study.


[PMID 19559392OA-icon.png] A candidate gene association study of 77 polymorphisms in migraine.


[PMID 20041166OA-icon.png] Common genetic variation and the control of HIV-1 in humans.


[PMID 20206716OA-icon.png] Genetic variation within the gene encoding the HIV-1 CCR5 coreceptor in two South African populations.


[PMID 20552027OA-icon.png] Host and viral genetic correlates of clinical definitions of HIV-1 disease progression.


[PMID 21854194] Distribution of polymorphisms in cytochrome P450 2B6, histocompatibility complex P5, chemokine coreceptor 5, and interleukin 28B genes in inhabitants from the central area of Argentina.


[PMID 22474614OA-icon.png] Host Genes Important to HIV Replication and Evolution.

GET Evidence
CCR5-S185Shift
aa_change Ser185Shift
aa_change_short S185Shift
impact protective
qualified_impact Low clinical importance, protective
overall_frequency 0.047619
summary Also known as CCR5-delta32, this variant is associated with resistance to many strains of HIV (but not all strains, only strains that use target the CCR5 protein). Heterozygotes are reported to have slower HIV progression, and homozygotes are very resistant to being infected by these strains.



[PMID 23632061] CCR2 and CCR5 genes polymorphisms in benign prostatic hyperplasia and prostate cancer [PMID 23107763] Host genetic risk factors for community-acquired pneumonia.