Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Serotonin synthesis[edit]

 On chromosomeChromosome positionIn geneSummary
rs1799913(C;C)1118,025,708TPH1Hispanics may be at increased risk of heroin addiction.
rs17999131118,025,708TPH1heroin addiction in hispanics
 On chromosomeChromosome positionIn geneSummary
rs4489789(T;T)1270,665,152PTPRRcommon in complete genomics
rs4570625(G;G)1271,938,143TPH2maybe: higher scores on anxiety-related personality traits; greater placebo response
rs4565946(C;C)1271,942,989TPH2Risk of early-onset OCD
rs17110563(C;C)1271,972,526TPH2common in complete genomics
rs120074176(C;T)1271,979,053TPH2Possible increased risk for ADHD and other psychiatric disorders
rs120074176(C;C)1271,979,053TPH2common in complete genomics
rs7305115(A;A)1271,979,082TPH2Individuals showed a significantly lower risk of suicide behavior than those with the A/G or G/G genotype
rs7305115(A;G)1271,979,082TPH2risk of suicide behavior
rs7305115(G;G)1271,979,082TPH2risk of suicide behavior
... further results
 On chromosomeChromosome positionIn geneSummary
rs201951824(C;C)750,476,625DDCcommon in clinvar
rs12718541(A;A)750,482,446DDCNicotine dependence
rs137853209(T;T)750,495,369DDCcommon in clinvar
rs137853212(G;G)750,499,201DDCcommon in clinvar
rs137853208(C;C)750,504,025DDCcommon in clinvar
rs137853210(A;A)750,529,339DDCcommon in clinvar
rs137853207(G;G)750,539,926DDCcommon in clinvar
rs137853211(C;C)750,539,958DDCcommon in clinvar
rs6264(G;G)750,544,037DDCcommon in complete genomics

Serotonin degradation[edit]

 On chromosomeChromosome positionIn geneSummary
rs796065312(C;C)X43,683,572MAOAcommon in clinvar
rs909525X43,693,955MAOABest proxy for Warrior Gene repeats.
rs909525(A;A)X43,693,955MAOAProbably MAOA 4 or 5 repeats: not Warrior Gene.
rs909525(G;G)X43,693,955MAOAPerhaps MAOA 3 repeats: Warrior Gene?
rs909525(A;G)X43,693,955MAOAProbably one Warrior Gene and one non-Warrior Gene.
rs587777457(G;G)X43,731,695MAOAcommon in clinvar
rs72554632(C;C)X43,731,784MAOAcommon in clinvar
rs72554632(C;T)X43,731,784MAOACarrier for Brunner's Syndrome
rs72554632(T;T)X43,731,784MAOApossible mental retardation
rs6323(T;T)X43,731,789MAOAreduced MAOA activity
rs6323(G;G)X43,731,789MAOAIncreased monoamine oxidase A activity
rs6323X43,731,789MAOAMonoamine oxidase A activity

Serotonin transporters[edit]

 On chromosomeChromosome positionIn geneSummary
rs1042173(T;T)1730,197,993SLC6A4among alcoholics, likely to be heavier drinkers
rs28914832(A;A)1730,211,356SLC6A4common in complete genomics
rs140701(G;G)1730,211,514SLC6A4Normal risk for anxiety disorders
rs140701(A;A)1730,211,514SLC6A4Increased risk for anxiety disorders
rs140701(A;G)1730,211,514SLC6A4Increased risk for anxiety disorders
rs2020942(A;G)1730,219,896SLC6A4common in complete genomics
rs2066713(C;T)1730,224,647SLC6A4common in complete genomics
rs25533(T;T)1730,235,874SLC6A4common in complete genomics
rs25532(C;C)1730,237,152SLC6A4may be part of a haplotype associated with OCD
rs25532(C;T)1730,237,152SLC6A4may be part of a haplotype associated with OCD
rs25531(A;A)1730,237,328SLC6A4short form of 5-HTTLPR. lower levels of serotonin, slightly less happy, benefits from more support
rs25531(G;G)1730,237,328SLC6A4long form of 5-HTTLPR. less sensitive to pain
rs4795541(-;AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG)1730,237,341SLC6A4complex; see details
 On chromosomeChromosome positionIn geneSummary
rs363224(A;A)10117,263,062SLC18A2Protective against TD occurrence

Serotonin receptors[edit]

 On chromosomeChromosome positionIn geneSummary
rs367956927(T;T)563,962,199HTR1Acommon in clinvar
rs6295(G;G)563,962,738HTR1Acommon in clinvar
 On chromosomeChromosome positionIn geneSummary
 On chromosomeChromosome positionIn geneSummary
rs3828741(C;C)687,015,956HTR1Ecommon in complete genomics
 On chromosomeChromosome positionIn geneSummary
rs6314(C;C)1346,834,899HTR2Ahigher risk for RA
rs6314(C;T)1346,834,899HTR2Ahigher risk for RA; better response to paroxetine as treatment for depression
rs7997012(A;A)1346,837,850HTR2A~18% more likely to respond to citalopram
rs7997012(G;G)1346,837,850HTR2A~18% less likely to respond to citalopram
rs7997012(A;G)1346,837,850HTR2Anormal risk
ADHD in adults
rs659734(T;T)1346,861,148HTR2Acommon in complete genomics
rs1328674(A;G)1346,867,572HTR2Ahigher risk for RA
rs1328674(A;A)1346,867,572HTR2Ahigher risk for RA
rs9534505(G;G)1346,886,609HTR2Acommon in complete genomics
rs6313(T;T)1346,895,805HTR2Adepression, panic, stress response
rs6313(C;C)1346,895,805HTR2Ahigher risk for RA
rs6313(C;T)1346,895,805HTR2Ahigher risk for RA
rs6311(C;T)1346,897,343HTR2ANormal risk of sexual dysfunction when taking SSRI Antidepressants.
rs6311(T;T)1346,897,343HTR2ANormal (lower) risk of sexual dysfunction when taking SSRI Antidepressants.
rs6311(C;C)1346,897,343HTR2A3.6x increased risk of sexual dysfunction when taking SSRI Antidepressants.
 On chromosomeChromosome positionIn geneSummary
2-3 fold higher risk of impulsive/aggressive behaviour when drunk
common in complete genomics
Increased risk for impulsive/aggressive behaviour when drunk
 On chromosomeChromosome positionIn geneSummary
rs3813929(C;C)X114,584,047HTR2Cpossible weight gain if taking olanzapine
rs518147(C;C)X114,584,109HTR2Cless weight gain if taking olanzapine
rs6318(G;G)X114,731,326HTR2Ccommon in clinvar
rs6318(C;G)X114,731,326HTR2CFemale only, since on X ch; appears to mostly be = to common (G;G) genotype
rs6318(C;C)X114,731,326HTR2C1.4x increased risk for cardiac events in patients; apparently stress (cortisol) related
rs1414334(C;C)X114,903,581HTR2Cassociated with metabolic syndrome when taking antipsychotics
 On chromosomeChromosome positionIn geneSummary
rs1150226(C;C)11113,974,819HTR3Acommon in complete genomics
 On chromosomeChromosome positionIn geneSummary
 On chromosomeChromosome positionIn geneSummary
rs118203884(T;T)MT4,409HTR3Ccommon in clinvar
rs6807362(C;C)3184,060,222HTR3Cincreased autism risk
rs6807362(G;G)3184,060,222HTR3Cdecreased autism risk
rs6807362(C;G)3184,060,222HTR3Cnormal autism risk
common in clinvar
 On chromosomeChromosome positionIn geneSummary
 On chromosomeChromosome positionIn geneSummary
rs56109847(G;G)3184,106,769HTR3Ecommon in complete genomics
 On chromosomeChromosome positionIn geneSummary
rs515726208(G;G)5147,824,702SPINK1common in clinvar
rs148954387(A;A)5147,828,020SPINK1common in clinvar
rs515726207(A;A)5147,828,056SPINK1common in clinvar
rs515726206(A;A)5147,828,066SPINK1common in clinvar
rs17107315(C;T)5147,828,115SPINK1risk of pancreatitis
rs17107315(C;C)5147,828,115SPINK1risk of pancreatitis
rs104893939(T;T)5147,831,537SPINK1common in clinvar
rs193922659(C;C)5147,831,551SPINK1common in clinvar
rs104893938(T;T)5147,831,576SPINK1common in clinvar
 On chromosomeChromosome positionIn geneSummary
rs10239794(T;T)7154,508,809DPP6>1.3x risk for ALS
rs10239794(C;T)7154,508,809DPP61.3x risk for ALS
 On chromosomeChromosome positionIn geneSummary
rs1805054(C;C)119,666,020HTR6common in complete genomics
 On chromosomeChromosome positionIn geneSummary
rs7895832(A;A)1092,516,769IDEcommon in complete genomics
rs17107734(C;C)1092,545,660IDEcommon in complete genomics
rs4646954(G;G)1092,574,070IDEcommon in complete genomics
rs3758505(T;T)1092,575,021IDEcommon in complete genomics
rs797045650(A;A)1092,609,068KIF11common in clinvar