Have questions? Visit https://www.reddit.com/r/SNPedia

rs878855140

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs878855140(-;TATATCAAATTGATATTTCAACAAC)
Make rs878855140(TATATCAAATTGATATTTCAACAAC;TATATCAAATTGATATTTCAACAAC)
ReferenceGRCh38.p2 38.2/147
Chromosome17
Position61780936
GeneBRIP1
is asnp
is mentioned by
dbSNPrs878855140
dbSNP (old)rs878855140
ClinGenrs878855140
ebirs878855140
HLIrs878855140
Exacrs878855140
Varsomers878855140
Maprs878855140
PheGenIrs878855140
Biobankrs878855140
1000 genomesrs878855140
hgdprs878855140
ensemblrs878855140
gopubmedrs878855140
geneviewrs878855140
scholarrs878855140
googlers878855140
pharmgkbrs878855140
gwascentralrs878855140
openSNPrs878855140
23andMers878855140
23andMe allrs878855140
SNP Nexus

SNPshotrs878855140
SNPdbers878855140
MSV3drs878855140
GWAS Ctlgrs878855140
Max Magnitude0
ClinVar
Risk rs878855140(TATATCAAATTGATATTTCAACAAC;TATATCAAATTGATATTTCAACAAC)
Alt rs878855140(TATATCAAATTGATATTTCAACAAC;TATATCAAATTGATATTTCAACAAC)
Reference Rs878855140(-;-)
Significance Pathogenic
Disease Familial cancer of breast Fanconi anemia not provided
Variation info
Gene BRIP1
CLNDBN Familial cancer of breast Fanconi anemia, complementation group J not provided
Reversed 1
HGVS NC_000017.10:g.59858297_59858298insGTTGTTGAAATATCAATTTGATATA
CLNSRC
CLNACC RCV000232677.1, RCV000483400.1,