Have questions? Visit https://www.reddit.com/r/SNPedia

rs878854345

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs878854345(-;GGCTGCGGCGGCGGCAGCGGC)
Make rs878854345(GGCTGCGGCGGCGGCAGCGGC;GGCTGCGGCGGCGGCAGCGGC)
ReferenceGRCh38.p2 38.2/147
Chromosome2
Position176093099
GeneHOXD13
is asnp
is mentioned by
dbSNPrs878854345
dbSNP (old)rs878854345
ClinGenrs878854345
ebirs878854345
HLIrs878854345
Exacrs878854345
Gnomadrs878854345
Varsomers878854345
Maprs878854345
PheGenIrs878854345
Biobankrs878854345
1000 genomesrs878854345
hgdprs878854345
ensemblrs878854345
gopubmedrs878854345
geneviewrs878854345
scholarrs878854345
googlers878854345
pharmgkbrs878854345
gwascentralrs878854345
openSNPrs878854345
23andMers878854345
23andMe allrs878854345
SNP Nexus

SNPshotrs878854345
SNPdbers878854345
MSV3drs878854345
GWAS Ctlgrs878854345
Max Magnitude0
ClinVar
Risk rs878854345(GCGGCGGCTGCGGCGGCGGCA;GCGGCGGCTGCGGCGGCGGCA)
Alt rs878854345(GCGGCGGCTGCGGCGGCGGCA;GCGGCGGCTGCGGCGGCGGCA)
Reference Rs878854345(-;-)
Significance Pathogenic
Disease Syndactyly
Variation info
Gene HOXD13
CLNDBN Syndactyly, type V
Reversed 0
HGVS NC_000002.11:g.176957827_176957828insGGCTGCGGCGGCGGCAGCGGC
CLNSRC OMIM Allelic Variant
CLNACC RCV000016001.25,