Have questions? Visit https://www.reddit.com/r/SNPedia

rs878854335

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs878854335(-;AACTTAGTGAACCAAGCCCTCCT)
Make rs878854335(AACTTAGTGAACCAAGCCCTCCT;AACTTAGTGAACCAAGCCCTCCT)
ReferenceGRCh38.p2 38.2/147
Chromosome2
Position178569952
GeneTTN, TTN-AS1
is asnp
is mentioned by
dbSNPrs878854335
dbSNP (old)rs878854335
ClinGenrs878854335
ebirs878854335
HLIrs878854335
Exacrs878854335
Gnomadrs878854335
Varsomers878854335
Maprs878854335
PheGenIrs878854335
Biobankrs878854335
1000 genomesrs878854335
hgdprs878854335
ensemblrs878854335
gopubmedrs878854335
geneviewrs878854335
scholarrs878854335
googlers878854335
pharmgkbrs878854335
gwascentralrs878854335
openSNPrs878854335
23andMers878854335
23andMe allrs878854335
SNP Nexus

SNPshotrs878854335
SNPdbers878854335
MSV3drs878854335
GWAS Ctlgrs878854335
Max Magnitude0
ClinVar
Risk rs878854335(AACTTAGTGAACCAAGCCCTCCT;AACTTAGTGAACCAAGCCCTCCT)
Alt rs878854335(AACTTAGTGAACCAAGCCCTCCT;AACTTAGTGAACCAAGCCCTCCT)
Reference Rs878854335(-;-)
Significance Pathogenic
Disease Dilated cardiomyopathy 1G
Variation info
Gene TTN TTN-AS1
CLNDBN Dilated cardiomyopathy 1G
Reversed 1
HGVS NC_000002.11:g.179434679_179434680insAGGAGGGCTTGGTTCACTAAGTT
CLNSRC
CLNACC RCV000228009.1,